ID: 1184879491

View in Genome Browser
Species Human (GRCh38)
Location 22:47295946-47295968
Sequence GTGTTGCTCTTTAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184879491_1184879498 -4 Left 1184879491 22:47295946-47295968 CCCTCCTCCTTAAAGAGCAACAC No data
Right 1184879498 22:47295965-47295987 ACACAGCAGGCTGGGTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184879491 Original CRISPR GTGTTGCTCTTTAAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr