ID: 1184879808

View in Genome Browser
Species Human (GRCh38)
Location 22:47297609-47297631
Sequence AGGGGCATTTTCCGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184879789_1184879808 30 Left 1184879789 22:47297556-47297578 CCCTTGGCTCTGAAGATGGAGCA No data
Right 1184879808 22:47297609-47297631 AGGGGCATTTTCCGGGCAGAGGG No data
1184879790_1184879808 29 Left 1184879790 22:47297557-47297579 CCTTGGCTCTGAAGATGGAGCAG No data
Right 1184879808 22:47297609-47297631 AGGGGCATTTTCCGGGCAGAGGG No data
1184879797_1184879808 3 Left 1184879797 22:47297583-47297605 CCTGCTGGGAGCTGGAGGGCCTG No data
Right 1184879808 22:47297609-47297631 AGGGGCATTTTCCGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184879808 Original CRISPR AGGGGCATTTTCCGGGCAGA GGG Intergenic
No off target data available for this crispr