ID: 1184881040

View in Genome Browser
Species Human (GRCh38)
Location 22:47304357-47304379
Sequence GGCGGTGCCTTCTGAGACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184881027_1184881040 19 Left 1184881027 22:47304315-47304337 CCGTGGTGCCTGCTGTACACACC No data
Right 1184881040 22:47304357-47304379 GGCGGTGCCTTCTGAGACAGAGG No data
1184881037_1184881040 -5 Left 1184881037 22:47304339-47304361 CCCTGGGAGGGACTGGAGGGCGG No data
Right 1184881040 22:47304357-47304379 GGCGGTGCCTTCTGAGACAGAGG No data
1184881039_1184881040 -6 Left 1184881039 22:47304340-47304362 CCTGGGAGGGACTGGAGGGCGGT No data
Right 1184881040 22:47304357-47304379 GGCGGTGCCTTCTGAGACAGAGG No data
1184881035_1184881040 -2 Left 1184881035 22:47304336-47304358 CCACCCTGGGAGGGACTGGAGGG No data
Right 1184881040 22:47304357-47304379 GGCGGTGCCTTCTGAGACAGAGG No data
1184881029_1184881040 11 Left 1184881029 22:47304323-47304345 CCTGCTGTACACACCACCCTGGG No data
Right 1184881040 22:47304357-47304379 GGCGGTGCCTTCTGAGACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184881040 Original CRISPR GGCGGTGCCTTCTGAGACAG AGG Intergenic