ID: 1184881340

View in Genome Browser
Species Human (GRCh38)
Location 22:47306376-47306398
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184881335_1184881340 -10 Left 1184881335 22:47306363-47306385 CCCCTACACCCTTGGTCCTGGTG No data
Right 1184881340 22:47306376-47306398 GGTCCTGGTGTTAGACATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184881340 Original CRISPR GGTCCTGGTGTTAGACATCT TGG Intergenic
No off target data available for this crispr