ID: 1184882880

View in Genome Browser
Species Human (GRCh38)
Location 22:47322575-47322597
Sequence CTCCTATAGCTGGCAGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184882873_1184882880 18 Left 1184882873 22:47322534-47322556 CCAGGTCTTGGGATTGAAAGATC No data
Right 1184882880 22:47322575-47322597 CTCCTATAGCTGGCAGGCTGTGG No data
1184882876_1184882880 -4 Left 1184882876 22:47322556-47322578 CCACTTTGAAGAGGGCCTGCTCC No data
Right 1184882880 22:47322575-47322597 CTCCTATAGCTGGCAGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184882880 Original CRISPR CTCCTATAGCTGGCAGGCTG TGG Intergenic
No off target data available for this crispr