ID: 1184884912

View in Genome Browser
Species Human (GRCh38)
Location 22:47337446-47337468
Sequence TCTCCATTGAAGGACCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184884907_1184884912 -8 Left 1184884907 22:47337431-47337453 CCTGCATTAATCTCCTCTCCATT No data
Right 1184884912 22:47337446-47337468 TCTCCATTGAAGGACCTGGAGGG No data
1184884903_1184884912 20 Left 1184884903 22:47337403-47337425 CCCCAACAGCTTCGTAAGCCTGT No data
Right 1184884912 22:47337446-47337468 TCTCCATTGAAGGACCTGGAGGG No data
1184884906_1184884912 2 Left 1184884906 22:47337421-47337443 CCTGTAATCTCCTGCATTAATCT No data
Right 1184884912 22:47337446-47337468 TCTCCATTGAAGGACCTGGAGGG No data
1184884905_1184884912 18 Left 1184884905 22:47337405-47337427 CCAACAGCTTCGTAAGCCTGTAA No data
Right 1184884912 22:47337446-47337468 TCTCCATTGAAGGACCTGGAGGG No data
1184884904_1184884912 19 Left 1184884904 22:47337404-47337426 CCCAACAGCTTCGTAAGCCTGTA No data
Right 1184884912 22:47337446-47337468 TCTCCATTGAAGGACCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184884912 Original CRISPR TCTCCATTGAAGGACCTGGA GGG Intergenic
No off target data available for this crispr