ID: 1184887323

View in Genome Browser
Species Human (GRCh38)
Location 22:47354374-47354396
Sequence GGCCCCCAGAGCCTCCCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184887321_1184887323 -6 Left 1184887321 22:47354357-47354379 CCCTGGCAGACTGGAGTGGCCCC No data
Right 1184887323 22:47354374-47354396 GGCCCCCAGAGCCTCCCTGATGG No data
1184887320_1184887323 -5 Left 1184887320 22:47354356-47354378 CCCCTGGCAGACTGGAGTGGCCC No data
Right 1184887323 22:47354374-47354396 GGCCCCCAGAGCCTCCCTGATGG No data
1184887322_1184887323 -7 Left 1184887322 22:47354358-47354380 CCTGGCAGACTGGAGTGGCCCCC No data
Right 1184887323 22:47354374-47354396 GGCCCCCAGAGCCTCCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184887323 Original CRISPR GGCCCCCAGAGCCTCCCTGA TGG Intergenic
No off target data available for this crispr