ID: 1184887495

View in Genome Browser
Species Human (GRCh38)
Location 22:47355338-47355360
Sequence GAGTAGCCACAGATGGCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184887487_1184887495 24 Left 1184887487 22:47355291-47355313 CCTGAGTCAGTCACTCTGGGATT No data
Right 1184887495 22:47355338-47355360 GAGTAGCCACAGATGGCATTTGG No data
1184887484_1184887495 30 Left 1184887484 22:47355285-47355307 CCAACACCTGAGTCAGTCACTCT No data
Right 1184887495 22:47355338-47355360 GAGTAGCCACAGATGGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184887495 Original CRISPR GAGTAGCCACAGATGGCATT TGG Intergenic
No off target data available for this crispr