ID: 1184887495 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:47355338-47355360 |
Sequence | GAGTAGCCACAGATGGCATT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1184887487_1184887495 | 24 | Left | 1184887487 | 22:47355291-47355313 | CCTGAGTCAGTCACTCTGGGATT | No data | ||
Right | 1184887495 | 22:47355338-47355360 | GAGTAGCCACAGATGGCATTTGG | No data | ||||
1184887484_1184887495 | 30 | Left | 1184887484 | 22:47355285-47355307 | CCAACACCTGAGTCAGTCACTCT | No data | ||
Right | 1184887495 | 22:47355338-47355360 | GAGTAGCCACAGATGGCATTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1184887495 | Original CRISPR | GAGTAGCCACAGATGGCATT TGG | Intergenic | ||
No off target data available for this crispr |