ID: 1184889850

View in Genome Browser
Species Human (GRCh38)
Location 22:47373008-47373030
Sequence TGCTGAACTGTATTCCATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 229}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184889850_1184889854 -3 Left 1184889850 22:47373008-47373030 CCAGCATGGAATACAGTTCAGCA 0: 1
1: 0
2: 0
3: 12
4: 229
Right 1184889854 22:47373028-47373050 GCAGGGCCAAAGAGGAGCAGTGG 0: 1
1: 0
2: 2
3: 56
4: 505
1184889850_1184889859 23 Left 1184889850 22:47373008-47373030 CCAGCATGGAATACAGTTCAGCA 0: 1
1: 0
2: 0
3: 12
4: 229
Right 1184889859 22:47373054-47373076 CATCTCAGGATGTGCTGGGCAGG 0: 1
1: 0
2: 2
3: 22
4: 217
1184889850_1184889857 18 Left 1184889850 22:47373008-47373030 CCAGCATGGAATACAGTTCAGCA 0: 1
1: 0
2: 0
3: 12
4: 229
Right 1184889857 22:47373049-47373071 GGCGTCATCTCAGGATGTGCTGG 0: 1
1: 0
2: 0
3: 3
4: 86
1184889850_1184889856 9 Left 1184889850 22:47373008-47373030 CCAGCATGGAATACAGTTCAGCA 0: 1
1: 0
2: 0
3: 12
4: 229
Right 1184889856 22:47373040-47373062 AGGAGCAGTGGCGTCATCTCAGG 0: 1
1: 0
2: 4
3: 27
4: 385
1184889850_1184889858 19 Left 1184889850 22:47373008-47373030 CCAGCATGGAATACAGTTCAGCA 0: 1
1: 0
2: 0
3: 12
4: 229
Right 1184889858 22:47373050-47373072 GCGTCATCTCAGGATGTGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184889850 Original CRISPR TGCTGAACTGTATTCCATGC TGG (reversed) Intergenic
901377810 1:8852165-8852187 TGCTGAACTGTTTTCCACAATGG - Intergenic
904982350 1:34517294-34517316 GGCTGCACAGTATTCCATGGTGG - Intergenic
905505897 1:38479216-38479238 TGTTGAACTGTTTTCCATAATGG - Intergenic
905567252 1:38975501-38975523 TGCTGAACTCTCTTCCATACTGG + Intergenic
909276963 1:73699178-73699200 TGCTGAATTGAATGCCATGTAGG + Intergenic
909402975 1:75254958-75254980 GGCTGCACTGAATGCCATGCTGG + Intronic
910898116 1:92090211-92090233 TGCTGAACTGTTTTCCAAACTGG + Intronic
911191854 1:94956288-94956310 TACTGAAATGTACTCCCTGCTGG - Intergenic
912205209 1:107500959-107500981 TTCTGTACTGGCTTCCATGCTGG - Intergenic
912553929 1:110502497-110502519 AGGTGAAGGGTATTCCATGCGGG + Intergenic
913194220 1:116441817-116441839 GGCTGCACAGTATTCCATGGTGG + Intergenic
913696587 1:121332233-121332255 TGCTGCACTGTTTTCCATCTTGG + Intronic
914140974 1:144947827-144947849 TGCTGCACTGTTTTCCATCTTGG - Intronic
914407896 1:147394389-147394411 TGCTGAGTAGTATTCCATGATGG + Intergenic
915253857 1:154610348-154610370 TGCTGTATTGTATTCCATCATGG - Intronic
917745190 1:177999955-177999977 TCCTGCACTGAATCCCATGCAGG + Intergenic
918960031 1:191262712-191262734 GGCTGAGTTGTATTCCATGGTGG - Intergenic
920447842 1:206033389-206033411 TGGTGAACTGCATTCCTTTCTGG + Intergenic
920483913 1:206350587-206350609 TGCTGCACTGTTTTCCATCTTGG + Intronic
921261276 1:213387108-213387130 TGTTGAACTGTCTTCCCTACTGG - Intergenic
921587156 1:216960940-216960962 TGCTCTACTGTATTCCTTGTAGG + Intronic
921811745 1:219522889-219522911 ATCTAAACTGTATTCCATCCAGG - Intergenic
923356808 1:233164671-233164693 GGCTGAATAGTATTCCATGGGGG - Intronic
923493084 1:234501559-234501581 TGCGCCACTGTATTCCAGGCTGG + Intergenic
924191773 1:241560974-241560996 TACTGTACTGTATTCCACACTGG + Intronic
1063481324 10:6379183-6379205 TGCACAACTGCATTCCATCCTGG + Intergenic
1064189211 10:13190640-13190662 TGCTCCACTGTACTCCAGGCTGG + Intronic
1065277055 10:24096062-24096084 TGCACCACTGTATTCCATCCTGG + Intronic
1065685456 10:28280099-28280121 TGCTGAACTGAATTCCTGGCTGG - Exonic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1066175187 10:32895952-32895974 TGCTGAACTGTTTTCCACAGTGG + Intergenic
1067141645 10:43662854-43662876 TGCTTCACTGTATTCCAGGCTGG - Intergenic
1069318750 10:67141525-67141547 GGCTGAACTCTATTCCAAGGGGG - Intronic
1069575033 10:69520892-69520914 TGCTGAGCTGTTTTCCATAGTGG + Intergenic
1071171537 10:82870504-82870526 TGCCGAACTGAATTCCAAGGTGG + Intronic
1071452136 10:85806377-85806399 TGCTGAACTGTTTTCCAAATTGG - Intronic
1072572989 10:96674934-96674956 TGCAGAACTGCATTCCAGCCTGG - Intronic
1072978937 10:100083105-100083127 TGCTAAACTGTTTTCCAAACTGG - Intergenic
1077480194 11:2811002-2811024 TGCTGCTCTGAATGCCATGCTGG - Intronic
1083040438 11:59680463-59680485 TGCTGACCTCTGTTCCATGGGGG + Intergenic
1083867839 11:65467376-65467398 TGCTGAACTGTTTTCCAGAGTGG - Intergenic
1085826626 11:79854771-79854793 TCCTCAACTGTGTTTCATGCCGG + Intergenic
1086049050 11:82567350-82567372 TGTTGAACTGTATTTAATACAGG - Intergenic
1087337450 11:96862627-96862649 TCCTGAAATGTTTTCCATGTTGG + Intergenic
1087543394 11:99549997-99550019 TGCTGGACCCTATTCCACGCAGG + Intronic
1088548187 11:110982722-110982744 TGTTGAACTCTATTCCTTCCTGG + Intergenic
1088836389 11:113581010-113581032 TCCATAACTGAATTCCATGCTGG + Intergenic
1089040286 11:115442007-115442029 TGCTGAACTGAATTCTGTGAAGG - Intronic
1093237044 12:16622445-16622467 TGCTGAAGTGTATTTTATACTGG - Intergenic
1095174769 12:39078950-39078972 GGCTGAACAGTATTCCATTGTGG - Intergenic
1095445689 12:42279850-42279872 GGCAGAACTGAATTCCTTGCAGG + Intronic
1095589468 12:43887664-43887686 TGCTGAATTTTTTTCCATCCAGG - Intronic
1095923035 12:47550111-47550133 GGCTGCACTGCATTCCATCCTGG + Intergenic
1097742150 12:63255746-63255768 TGCTGTACTGTTTTCCATAGTGG - Intergenic
1098976002 12:76902761-76902783 TGCTGAATTGTATTCCTAGGAGG + Intergenic
1100872864 12:98930353-98930375 TGCTGAACTGTTTTCCAAAGTGG - Intronic
1102410905 12:112717807-112717829 TGCCAAACTGTTTTCCATGGTGG + Intronic
1103206282 12:119131512-119131534 TGCTTAATTCTATTCAATGCTGG - Intronic
1105245835 13:18649359-18649381 TGCTCAACTGTACTCCAGCCTGG + Intergenic
1106387235 13:29299659-29299681 TGGGGAACTGCATTCCATTCAGG + Intronic
1109781222 13:67112759-67112781 TGTTCAACTGTACTCCAGGCTGG - Intronic
1110210909 13:72972076-72972098 TGCTCCACTGTATTCCAGCCTGG - Intronic
1110248712 13:73357179-73357201 TCCTGAAGTGGATTCCATGGTGG + Intergenic
1110708571 13:78624781-78624803 AACTAAACTGTGTTCCATGCTGG + Intronic
1110813525 13:79837062-79837084 AGCTGAAAAGTATGCCATGCTGG - Intergenic
1112590155 13:100755855-100755877 TGCGCCACTGTATTCCATCCTGG + Intergenic
1112670303 13:101628015-101628037 TGCTGAACTGTCTTCCAAAGAGG + Intronic
1114160441 14:20160078-20160100 TGCTGAACTGTCTTCCAAAGTGG + Intergenic
1114546293 14:23504338-23504360 TGCTGAACTGTCTTCCAAACTGG + Intronic
1114994893 14:28336560-28336582 GGCTGCACAGTATTCCATGTGGG - Intergenic
1115733539 14:36298071-36298093 TGATGCACTGTATTCCAGCCTGG - Intergenic
1116249689 14:42465171-42465193 TGCGCCACTGTATTCCAGGCTGG - Intergenic
1116528914 14:45942860-45942882 TACTGAACTGTCTTCCAAACTGG + Intergenic
1120049069 14:79844093-79844115 GGCTGAATAGTATTCCATGGTGG + Intronic
1121184619 14:91955811-91955833 AGCTGAACTTTCTGCCATGCTGG + Intergenic
1122453433 14:101830767-101830789 TGCTTCTCTGTATTCCTTGCTGG - Intronic
1122851420 14:104534288-104534310 TGCTGAACTGTCTTCCAAAGTGG + Intronic
1124245080 15:28062138-28062160 TGCTGAACTGTTTTCCAAAATGG + Intronic
1124874367 15:33578178-33578200 TGCTACACTGTATTCCATAATGG - Intronic
1125315652 15:38428358-38428380 TGCTGAACTATATACCCTGAGGG - Intergenic
1126277762 15:46904157-46904179 TGCTGAATTGTATTTCTTTCTGG + Intergenic
1126359978 15:47836102-47836124 TGCTGAACTGTTTTCCAAAGTGG - Intergenic
1126525864 15:49653401-49653423 AGCTGAACTGCATTCCTTTCTGG - Exonic
1128659249 15:69485870-69485892 TGCTGAACTGTTTTCCAGAGTGG + Intergenic
1128984293 15:72207954-72207976 TGCTGAGTTGTATTCCTAGCAGG + Intronic
1129183304 15:73890497-73890519 TGGAGAACTGTCTTTCATGCGGG - Intergenic
1131044641 15:89304126-89304148 TGCTGAACAGTTTTCCATAGTGG - Intronic
1131800193 15:96060458-96060480 TGCTGCACAGTATTACTTGCAGG + Intergenic
1132046772 15:98570064-98570086 TGCTGAACTGTTTTCCATAGCGG - Intergenic
1136705422 16:32184122-32184144 TGCTGAACTGTTTTCCAAAGTGG - Intergenic
1140922523 16:79552255-79552277 TGCTGAACTGCACTCCAATCTGG - Intergenic
1144022446 17:11249375-11249397 TGCAGAGCTATATTCTATGCAGG - Intronic
1146027469 17:29333922-29333944 TAGTGAAGTGTATTCCAGGCAGG + Intergenic
1146059056 17:29594947-29594969 TGCAGAGCTGGATGCCATGCAGG - Intronic
1146287189 17:31581913-31581935 TGCTGAAGTGTACTCCTGGCCGG - Intergenic
1148313796 17:46673889-46673911 GGCTGAATAGTATTCCATGGGGG + Intronic
1148433159 17:47659303-47659325 TGCAGCACTGTATTCCAGCCTGG + Intronic
1148969496 17:51467296-51467318 TGCTCCACTGTATTCCATCCTGG + Intergenic
1149245611 17:54702577-54702599 TGCCAAACTGTATTCCATAGTGG - Intergenic
1153720402 18:7895998-7896020 CGATTAGCTGTATTCCATGCAGG - Intronic
1154443082 18:14410299-14410321 TGCTCAACTGTACTCCAGCCTGG - Intergenic
1154930332 18:20988107-20988129 TGCACCACTGTATTCCATCCTGG - Intronic
1156310173 18:35914935-35914957 TGCTGAGCAGAATTCCATGGCGG + Intergenic
1157328021 18:46682920-46682942 TGCAGAACTGCATTCCTTTCTGG - Intronic
1157849492 18:51034586-51034608 TGCAGCACTGTACTCCAGGCTGG - Intronic
1158591111 18:58779597-58779619 TTCACAACTGTATTCCTTGCCGG + Intergenic
1159670210 18:71212689-71212711 TGCTGTACTGGATTTCTTGCAGG - Intergenic
1159819074 18:73116794-73116816 TGCTGAAGTGTAATGCATCCTGG + Intergenic
1160100933 18:75918310-75918332 TTTTGAGCTGTATTCCAGGCAGG - Intergenic
1160177583 18:76608402-76608424 TGCAGCACTGTATTCCAGCCTGG + Intergenic
1163351930 19:16782420-16782442 TGCACCACTGTATTCCATCCTGG + Intronic
1166078999 19:40431740-40431762 TGCTGCGCTGTACTCCATCCTGG + Intergenic
1168479447 19:56706747-56706769 TCCTGAACTTTATTCAATACAGG - Intergenic
926081187 2:9987709-9987731 GGCTGAGCTGGATTCAATGCAGG + Intronic
926952767 2:18261530-18261552 TGCTCCACTGTACTCCAGGCTGG - Intronic
928900925 2:36316670-36316692 TGCAAATCTATATTCCATGCAGG - Intergenic
929347461 2:40903357-40903379 AGCTGAGCTGTAGTCCATGAAGG - Intergenic
931076154 2:58715339-58715361 TGTTGAGCTGCATTCAATGCTGG - Intergenic
933603960 2:84361377-84361399 GGCTGGACTGTTCTCCATGCAGG + Intergenic
938471989 2:131573048-131573070 GGCTGAATAGTATTCCATGGTGG + Intergenic
938675487 2:133629550-133629572 TGCCACACTGTCTTCCATGCTGG - Intergenic
940163881 2:150746239-150746261 TGCTGAACTGTCTTCCAAAGTGG - Intergenic
943794650 2:191977160-191977182 AGCAGAAGAGTATTCCATGCTGG + Intronic
945003192 2:205374278-205374300 TGCTCCACTGTATTCCAGCCTGG - Intronic
946058813 2:216924094-216924116 TGCCGAACTGTTTTCCATAGTGG + Intergenic
947965639 2:234279345-234279367 TGCTGAGTAGTATTCCATGATGG - Intergenic
948241850 2:236444572-236444594 TGCTGAAATGTTTCCCATGATGG + Intronic
1173680013 20:44872172-44872194 TGCCCAGCTGTATTCCATGATGG - Intergenic
1174333126 20:49836751-49836773 TGCCAAACTGTTTTCCATGGTGG + Intronic
1176189213 20:63799884-63799906 TGCTGAACTGTTTTCCACAGCGG - Intronic
1176516240 21:7785802-7785824 TGCTGGACTGCATTCCAGGAGGG + Intergenic
1178650268 21:34415814-34415836 TGCTGGACTGCATTCCAGGAGGG + Intergenic
1179116183 21:38494718-38494740 TCCTGCACTGTATTTCATGGGGG + Intronic
1179525119 21:41971072-41971094 AGCTGTGCTCTATTCCATGCTGG + Intergenic
1183756262 22:39768846-39768868 TACTGAACTGTATTAAATGCAGG + Intronic
1183849053 22:40568334-40568356 CTCTGTACTGTATTCCATGAAGG - Intronic
1184218057 22:43080480-43080502 TTCTGAACTGTATTACTTACTGG + Intronic
1184889850 22:47373008-47373030 TGCTGAACTGTATTCCATGCTGG - Intergenic
949838334 3:8293099-8293121 TGATGAACTGGATTGCTTGCTGG - Intergenic
951022491 3:17796279-17796301 TGCTAAACTGTTTTCCATAGTGG + Intronic
953142067 3:40238324-40238346 TGCTCAGCTGAATTCCATCCGGG - Intronic
953329710 3:42042781-42042803 TTAAGAACTGTATTCCATCCTGG - Intronic
954863556 3:53710238-53710260 TGCTGAGCTGGATTCCTAGCAGG + Intronic
954977702 3:54712307-54712329 AGCTGAACTGTATTCCTTTCTGG + Intronic
956156828 3:66307076-66307098 TGCTGCACTGTCTTCCATAATGG + Intronic
958727890 3:97928196-97928218 GGCTGCACAGTATTCCATGGTGG - Intronic
961280462 3:125762638-125762660 TGCTGAACTGAAATCCACCCTGG + Intergenic
961462357 3:127059484-127059506 TGCTGAACTCTTTTCCAGACTGG + Intergenic
961552074 3:127675123-127675145 TGCAGAACGGCAGTCCATGCAGG - Intronic
961612061 3:128147675-128147697 TGCTGAACTGTTTTCCAGAGTGG - Intronic
961713426 3:128843854-128843876 TGCCACACTGTATTCCATGGTGG - Intergenic
962332924 3:134495916-134495938 GGCTGAATAGTATTCCATGATGG + Intronic
965294544 3:166926879-166926901 TGAAGAACTGTATTCCTTTCAGG + Intergenic
970073047 4:12184014-12184036 TGCACCACTGTATTCCAGGCTGG + Intergenic
974176471 4:58332276-58332298 TAGTGAACTGTATTCCAGGATGG + Intergenic
974907640 4:68077584-68077606 TGCTGTGCTGTTTTCCTTGCTGG - Intronic
976314384 4:83643665-83643687 TTCTGAAGTGTATTCCACTCAGG - Intergenic
980537948 4:134153675-134153697 TCTTGATCTGTAGTCCATGCTGG + Intergenic
982135468 4:152270697-152270719 TCCTGAATTGTACTCCATGTAGG - Intergenic
982600610 4:157443952-157443974 AGCTAGACTGTTTTCCATGCAGG - Intergenic
986546178 5:8900118-8900140 TGCCGAATTGTGTTCCATACAGG - Intergenic
987118165 5:14742760-14742782 TGCTGCACTGCATTTCAAGCAGG + Intronic
988048586 5:25992599-25992621 TGATGAACTGATTTCCATGATGG + Intergenic
988091976 5:26554799-26554821 GGCTGAGCAGTATTCCATGGTGG - Intergenic
989013549 5:36901827-36901849 TGCTGAACTGTTTTCCACAGTGG + Intronic
989327644 5:40218229-40218251 GGCTGAATAGTATTCCATGGTGG + Intergenic
989610373 5:43285106-43285128 TGCTATACTGTCTTCCATGATGG + Intergenic
990808350 5:59692637-59692659 TGCTGAACTAGATTCTATGTTGG + Intronic
991142159 5:63257458-63257480 TGCTCCACTGTATTCCAGCCTGG - Intergenic
992711024 5:79456100-79456122 AGCTGAGCTGTACTCCAGGCTGG + Intronic
992956328 5:81912625-81912647 TGCTGAACTGTCTTCCAAAGTGG - Intergenic
997075457 5:130669816-130669838 TGCTGTACTGTTTTCCATAATGG - Intergenic
999660952 5:153862387-153862409 TACTGAGCTGTAATCCATGTTGG + Intergenic
1000311179 5:160046304-160046326 TGATAAACTGTATTAAATGCAGG - Intronic
1002957181 6:1877592-1877614 TGCACCACTGTATTCCATCCTGG + Intronic
1004691130 6:17992997-17993019 TGCTGGACAGTATCCCATTCTGG + Intergenic
1004851071 6:19699694-19699716 TTCTGAACGTTATTCCATGGTGG - Intergenic
1007467826 6:42067260-42067282 TGCGCCACTGTATTCCAGGCTGG - Intronic
1008356429 6:50559350-50559372 TGCTAAACTGTTTTCCGTGGTGG - Intergenic
1013412911 6:109897674-109897696 TGCTGGAGGGGATTCCATGCAGG + Intergenic
1013473687 6:110488115-110488137 TGCTGAGCTGCATTCCCAGCTGG + Intergenic
1016055798 6:139576764-139576786 TGCTTCACTGGATTCCAAGCTGG - Intergenic
1016313365 6:142758727-142758749 TGCTTAAATGTAATCCATGGTGG + Intronic
1018822390 6:167383387-167383409 AGCTGAAGTGTTTTCCATGGAGG - Intronic
1019759065 7:2795582-2795604 TGCTGCACTATATTCTAGGCTGG + Intronic
1021677252 7:23093623-23093645 TGCTGAACTGTTTTCCAAAGTGG + Intergenic
1021677931 7:23099441-23099463 TGCACAACTGTACTCCATGCTGG + Intergenic
1023693807 7:42823859-42823881 TGCTCAACTGTTTTCCAGGGTGG - Intergenic
1024032544 7:45475669-45475691 TGCTAATCTGTTTTCCATGGTGG - Intergenic
1026097625 7:67359036-67359058 AACTGAACTGTATTGCATGGGGG - Intergenic
1026372118 7:69710834-69710856 TTCTGAACTGTATTTCATTTAGG + Intronic
1026586424 7:71659758-71659780 TGCTGGACTGTATTCAAAGATGG - Intronic
1027233183 7:76283414-76283436 TGCAGAGCTGAATTCCATGCCGG - Intronic
1027392201 7:77715675-77715697 TGCTGAACTGTTTTCCAAAGTGG + Intronic
1027956654 7:84887425-84887447 GGCTGAACTGTTCTCCCTGCAGG - Intergenic
1029392723 7:100286361-100286383 TGCTGAACTGTACCCCCTGATGG + Intergenic
1030213672 7:107021435-107021457 GGCTGACTTGAATTCCATGCTGG + Intergenic
1031062453 7:117067312-117067334 TGCTGAACTGTTTTCCAAAGTGG + Intronic
1031513726 7:122677773-122677795 TGCTGAACTTGATTGCATGGTGG - Intronic
1034026817 7:147713711-147713733 TGCTAAACTGTTTTCTATGGTGG + Intronic
1034636085 7:152568306-152568328 TTCTAAACTGTTTGCCATGCTGG + Intergenic
1034978210 7:155459941-155459963 TCATCAACTGCATTCCATGCGGG + Intronic
1035098125 7:156373477-156373499 TGCAGCACTGTACTCCATCCTGG - Intergenic
1035196034 7:157221336-157221358 TGCAGAACTGTGTTCCAGGGTGG + Intronic
1035252167 7:157604492-157604514 TGCAGAATTTTATACCATGCTGG + Intronic
1036830911 8:12018985-12019007 TGCTGAACTGAAATCCACCCTGG - Intergenic
1039654267 8:39382418-39382440 TGCTCCACTGTCTTCCATGGTGG + Intergenic
1042734263 8:71969961-71969983 GGCTGCAGAGTATTCCATGCTGG + Intronic
1044554590 8:93549314-93549336 GGCTGCACAGTATTCCATGGTGG - Intergenic
1044681580 8:94784091-94784113 TGCACAACTGTATTCCAGCCTGG - Intronic
1046501869 8:115087998-115088020 TGCCAAACTGTATTCCAAACTGG + Intergenic
1046854021 8:119008638-119008660 TGCTTTAATGTATTCCATGAGGG - Intronic
1047192942 8:122695056-122695078 TGCCAAACTGTTTTCCATGGTGG - Intergenic
1050531478 9:6593734-6593756 TGCTCCACTGTACTCCATCCTGG - Intronic
1051135318 9:13913677-13913699 GGCTGAACAGTATTCCATTGTGG + Intergenic
1052016860 9:23479101-23479123 TGCAGAACTGTGTTCCTTACTGG + Intergenic
1054742553 9:68822916-68822938 TGCAGAGCTGTATTCCTTCCTGG + Intronic
1055359557 9:75475310-75475332 TGCTTAACTGTGGTCCAGGCTGG + Intergenic
1056498175 9:87180890-87180912 TACTGTACTGTTTTCCATGGTGG - Intergenic
1057251214 9:93504131-93504153 GGAAGAAGTGTATTCCATGCAGG + Intronic
1059475342 9:114542122-114542144 GGCTGAAATGAATTGCATGCTGG + Intergenic
1060489348 9:124071049-124071071 TGCTGTACTCTTTTCCATGATGG + Intergenic
1061320850 9:129828301-129828323 TGCTAGACTTTACTCCATGCAGG + Intronic
1185465581 X:352574-352596 TGCTGAACCCTATTCCATTATGG + Intronic
1185748148 X:2588226-2588248 GGCTGAATAGTATTCCATGATGG - Intergenic
1186304681 X:8243021-8243043 TGTTGAACTGAATTCTATGATGG + Intergenic
1187128085 X:16473043-16473065 TGCTGAACTGTCTTCCAAGGTGG - Intergenic
1187439521 X:19305582-19305604 TGTTGAACTGTACTCTGTGCTGG - Intergenic
1188551243 X:31367123-31367145 TGTAGAACGGTATTCCATTCTGG + Intronic
1188854639 X:35178057-35178079 TACTCTACTTTATTCCATGCTGG + Intergenic
1189949237 X:46211946-46211968 TGCCGAACTGTTTTCCAAACTGG + Intergenic
1192541996 X:71981890-71981912 TGCTGTACTGTTTTCCATAGAGG - Intergenic
1193613174 X:83656472-83656494 GGCTGCACAGTATTCCATGGTGG + Intergenic
1193877844 X:86884151-86884173 GGCTGCATAGTATTCCATGCTGG + Intergenic
1195511550 X:105721537-105721559 TGCCTAACTGTATTCCAAACTGG + Intronic
1197487844 X:127075392-127075414 TGCTGGACTGTATTCTACCCTGG + Intergenic
1197730903 X:129809135-129809157 TGCTGAACTGTTTTCCAAAGTGG - Intronic
1199475814 X:148243919-148243941 TCCTGTTCTGTATTCCATTCTGG - Intergenic
1201262314 Y:12171620-12171642 TGCAGAACTGAATTCAATTCCGG - Intergenic
1201480729 Y:14436723-14436745 TGCTGCACTGCATTCCAAGAAGG - Intergenic
1201641593 Y:16184039-16184061 TGCAGCACTGTACTCCAGGCTGG - Intergenic
1201661222 Y:16401283-16401305 TGCAGCACTGTACTCCAGGCTGG + Intergenic