ID: 1184891200

View in Genome Browser
Species Human (GRCh38)
Location 22:47380489-47380511
Sequence CAGGTATGGGCCACCACGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 332854
Summary {0: 7, 1: 782, 2: 21274, 3: 99378, 4: 211413}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184891200_1184891211 22 Left 1184891200 22:47380489-47380511 CCAGGCGTGGTGGCCCATACCTG 0: 7
1: 782
2: 21274
3: 99378
4: 211413
Right 1184891211 22:47380534-47380556 TGAGGCAGGCAGGTCACTTGAGG 0: 59
1: 2382
2: 10833
3: 30969
4: 60396
1184891200_1184891203 -6 Left 1184891200 22:47380489-47380511 CCAGGCGTGGTGGCCCATACCTG 0: 7
1: 782
2: 21274
3: 99378
4: 211413
Right 1184891203 22:47380506-47380528 TACCTGTAATTCCAGCACTTTGG 0: 255
1: 12660
2: 183362
3: 311844
4: 208558
1184891200_1184891204 -5 Left 1184891200 22:47380489-47380511 CCAGGCGTGGTGGCCCATACCTG 0: 7
1: 782
2: 21274
3: 99378
4: 211413
Right 1184891204 22:47380507-47380529 ACCTGTAATTCCAGCACTTTGGG 0: 3111
1: 86006
2: 313232
3: 241847
4: 148165
1184891200_1184891209 8 Left 1184891200 22:47380489-47380511 CCAGGCGTGGTGGCCCATACCTG 0: 7
1: 782
2: 21274
3: 99378
4: 211413
Right 1184891209 22:47380520-47380542 GCACTTTGGGAGGCTGAGGCAGG 0: 59629
1: 175979
2: 229415
3: 270535
4: 297068
1184891200_1184891210 12 Left 1184891200 22:47380489-47380511 CCAGGCGTGGTGGCCCATACCTG 0: 7
1: 782
2: 21274
3: 99378
4: 211413
Right 1184891210 22:47380524-47380546 TTTGGGAGGCTGAGGCAGGCAGG 0: 375
1: 1663
2: 3864
3: 6052
4: 7673
1184891200_1184891206 -2 Left 1184891200 22:47380489-47380511 CCAGGCGTGGTGGCCCATACCTG 0: 7
1: 782
2: 21274
3: 99378
4: 211413
Right 1184891206 22:47380510-47380532 TGTAATTCCAGCACTTTGGGAGG 0: 11596
1: 306145
2: 263594
3: 149163
4: 135954
1184891200_1184891212 27 Left 1184891200 22:47380489-47380511 CCAGGCGTGGTGGCCCATACCTG 0: 7
1: 782
2: 21274
3: 99378
4: 211413
Right 1184891212 22:47380539-47380561 CAGGCAGGTCACTTGAGGCTAGG No data
1184891200_1184891207 4 Left 1184891200 22:47380489-47380511 CCAGGCGTGGTGGCCCATACCTG 0: 7
1: 782
2: 21274
3: 99378
4: 211413
Right 1184891207 22:47380516-47380538 TCCAGCACTTTGGGAGGCTGAGG 0: 4261
1: 95514
2: 216800
3: 242347
4: 268001

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184891200 Original CRISPR CAGGTATGGGCCACCACGCC TGG (reversed) Intergenic
Too many off-targets to display for this crispr