ID: 1184891201

View in Genome Browser
Species Human (GRCh38)
Location 22:47380502-47380524
Sequence AGTGCTGGAATTACAGGTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184891201_1184891210 -1 Left 1184891201 22:47380502-47380524 CCCATACCTGTAATTCCAGCACT No data
Right 1184891210 22:47380524-47380546 TTTGGGAGGCTGAGGCAGGCAGG 0: 375
1: 1663
2: 3864
3: 6052
4: 7673
1184891201_1184891215 28 Left 1184891201 22:47380502-47380524 CCCATACCTGTAATTCCAGCACT No data
Right 1184891215 22:47380553-47380575 GAGGCTAGGAGTTTGGGACGAGG No data
1184891201_1184891213 21 Left 1184891201 22:47380502-47380524 CCCATACCTGTAATTCCAGCACT No data
Right 1184891213 22:47380546-47380568 GTCACTTGAGGCTAGGAGTTTGG No data
1184891201_1184891212 14 Left 1184891201 22:47380502-47380524 CCCATACCTGTAATTCCAGCACT No data
Right 1184891212 22:47380539-47380561 CAGGCAGGTCACTTGAGGCTAGG No data
1184891201_1184891209 -5 Left 1184891201 22:47380502-47380524 CCCATACCTGTAATTCCAGCACT No data
Right 1184891209 22:47380520-47380542 GCACTTTGGGAGGCTGAGGCAGG 0: 59629
1: 175979
2: 229415
3: 270535
4: 297068
1184891201_1184891207 -9 Left 1184891201 22:47380502-47380524 CCCATACCTGTAATTCCAGCACT No data
Right 1184891207 22:47380516-47380538 TCCAGCACTTTGGGAGGCTGAGG 0: 4261
1: 95514
2: 216800
3: 242347
4: 268001
1184891201_1184891211 9 Left 1184891201 22:47380502-47380524 CCCATACCTGTAATTCCAGCACT No data
Right 1184891211 22:47380534-47380556 TGAGGCAGGCAGGTCACTTGAGG 0: 59
1: 2382
2: 10833
3: 30969
4: 60396
1184891201_1184891214 22 Left 1184891201 22:47380502-47380524 CCCATACCTGTAATTCCAGCACT No data
Right 1184891214 22:47380547-47380569 TCACTTGAGGCTAGGAGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184891201 Original CRISPR AGTGCTGGAATTACAGGTAT GGG (reversed) Intergenic
No off target data available for this crispr