ID: 1184891202

View in Genome Browser
Species Human (GRCh38)
Location 22:47380503-47380525
Sequence AAGTGCTGGAATTACAGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184891202_1184891212 13 Left 1184891202 22:47380503-47380525 CCATACCTGTAATTCCAGCACTT No data
Right 1184891212 22:47380539-47380561 CAGGCAGGTCACTTGAGGCTAGG No data
1184891202_1184891215 27 Left 1184891202 22:47380503-47380525 CCATACCTGTAATTCCAGCACTT No data
Right 1184891215 22:47380553-47380575 GAGGCTAGGAGTTTGGGACGAGG No data
1184891202_1184891209 -6 Left 1184891202 22:47380503-47380525 CCATACCTGTAATTCCAGCACTT No data
Right 1184891209 22:47380520-47380542 GCACTTTGGGAGGCTGAGGCAGG No data
1184891202_1184891210 -2 Left 1184891202 22:47380503-47380525 CCATACCTGTAATTCCAGCACTT No data
Right 1184891210 22:47380524-47380546 TTTGGGAGGCTGAGGCAGGCAGG No data
1184891202_1184891211 8 Left 1184891202 22:47380503-47380525 CCATACCTGTAATTCCAGCACTT No data
Right 1184891211 22:47380534-47380556 TGAGGCAGGCAGGTCACTTGAGG No data
1184891202_1184891214 21 Left 1184891202 22:47380503-47380525 CCATACCTGTAATTCCAGCACTT No data
Right 1184891214 22:47380547-47380569 TCACTTGAGGCTAGGAGTTTGGG No data
1184891202_1184891213 20 Left 1184891202 22:47380503-47380525 CCATACCTGTAATTCCAGCACTT No data
Right 1184891213 22:47380546-47380568 GTCACTTGAGGCTAGGAGTTTGG No data
1184891202_1184891207 -10 Left 1184891202 22:47380503-47380525 CCATACCTGTAATTCCAGCACTT No data
Right 1184891207 22:47380516-47380538 TCCAGCACTTTGGGAGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184891202 Original CRISPR AAGTGCTGGAATTACAGGTA TGG (reversed) Intergenic