ID: 1184891205

View in Genome Browser
Species Human (GRCh38)
Location 22:47380508-47380530
Sequence TCCCAAAGTGCTGGAATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 852741
Summary {0: 11218, 1: 302003, 2: 259881, 3: 147035, 4: 132604}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184891205_1184891210 -7 Left 1184891205 22:47380508-47380530 CCTGTAATTCCAGCACTTTGGGA 0: 11218
1: 302003
2: 259881
3: 147035
4: 132604
Right 1184891210 22:47380524-47380546 TTTGGGAGGCTGAGGCAGGCAGG 0: 375
1: 1663
2: 3864
3: 6052
4: 7673
1184891205_1184891211 3 Left 1184891205 22:47380508-47380530 CCTGTAATTCCAGCACTTTGGGA 0: 11218
1: 302003
2: 259881
3: 147035
4: 132604
Right 1184891211 22:47380534-47380556 TGAGGCAGGCAGGTCACTTGAGG 0: 59
1: 2382
2: 10833
3: 30969
4: 60396
1184891205_1184891212 8 Left 1184891205 22:47380508-47380530 CCTGTAATTCCAGCACTTTGGGA 0: 11218
1: 302003
2: 259881
3: 147035
4: 132604
Right 1184891212 22:47380539-47380561 CAGGCAGGTCACTTGAGGCTAGG No data
1184891205_1184891216 27 Left 1184891205 22:47380508-47380530 CCTGTAATTCCAGCACTTTGGGA 0: 11218
1: 302003
2: 259881
3: 147035
4: 132604
Right 1184891216 22:47380558-47380580 TAGGAGTTTGGGACGAGGCTAGG No data
1184891205_1184891215 22 Left 1184891205 22:47380508-47380530 CCTGTAATTCCAGCACTTTGGGA 0: 11218
1: 302003
2: 259881
3: 147035
4: 132604
Right 1184891215 22:47380553-47380575 GAGGCTAGGAGTTTGGGACGAGG No data
1184891205_1184891214 16 Left 1184891205 22:47380508-47380530 CCTGTAATTCCAGCACTTTGGGA 0: 11218
1: 302003
2: 259881
3: 147035
4: 132604
Right 1184891214 22:47380547-47380569 TCACTTGAGGCTAGGAGTTTGGG No data
1184891205_1184891213 15 Left 1184891205 22:47380508-47380530 CCTGTAATTCCAGCACTTTGGGA 0: 11218
1: 302003
2: 259881
3: 147035
4: 132604
Right 1184891213 22:47380546-47380568 GTCACTTGAGGCTAGGAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184891205 Original CRISPR TCCCAAAGTGCTGGAATTAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr