ID: 1184891207

View in Genome Browser
Species Human (GRCh38)
Location 22:47380516-47380538
Sequence TCCAGCACTTTGGGAGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 826923
Summary {0: 4261, 1: 95514, 2: 216800, 3: 242347, 4: 268001}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184891201_1184891207 -9 Left 1184891201 22:47380502-47380524 CCCATACCTGTAATTCCAGCACT No data
Right 1184891207 22:47380516-47380538 TCCAGCACTTTGGGAGGCTGAGG 0: 4261
1: 95514
2: 216800
3: 242347
4: 268001
1184891202_1184891207 -10 Left 1184891202 22:47380503-47380525 CCATACCTGTAATTCCAGCACTT No data
Right 1184891207 22:47380516-47380538 TCCAGCACTTTGGGAGGCTGAGG 0: 4261
1: 95514
2: 216800
3: 242347
4: 268001
1184891200_1184891207 4 Left 1184891200 22:47380489-47380511 CCAGGCGTGGTGGCCCATACCTG 0: 7
1: 782
2: 21274
3: 99378
4: 211413
Right 1184891207 22:47380516-47380538 TCCAGCACTTTGGGAGGCTGAGG 0: 4261
1: 95514
2: 216800
3: 242347
4: 268001

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184891207 Original CRISPR TCCAGCACTTTGGGAGGCTG AGG Intergenic
Too many off-targets to display for this crispr