ID: 1184891208

View in Genome Browser
Species Human (GRCh38)
Location 22:47380517-47380539
Sequence GCCTCAGCCTCCCAAAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184891208_1184891215 13 Left 1184891208 22:47380517-47380539 CCAGCACTTTGGGAGGCTGAGGC No data
Right 1184891215 22:47380553-47380575 GAGGCTAGGAGTTTGGGACGAGG No data
1184891208_1184891214 7 Left 1184891208 22:47380517-47380539 CCAGCACTTTGGGAGGCTGAGGC No data
Right 1184891214 22:47380547-47380569 TCACTTGAGGCTAGGAGTTTGGG No data
1184891208_1184891213 6 Left 1184891208 22:47380517-47380539 CCAGCACTTTGGGAGGCTGAGGC No data
Right 1184891213 22:47380546-47380568 GTCACTTGAGGCTAGGAGTTTGG No data
1184891208_1184891211 -6 Left 1184891208 22:47380517-47380539 CCAGCACTTTGGGAGGCTGAGGC No data
Right 1184891211 22:47380534-47380556 TGAGGCAGGCAGGTCACTTGAGG No data
1184891208_1184891217 26 Left 1184891208 22:47380517-47380539 CCAGCACTTTGGGAGGCTGAGGC No data
Right 1184891217 22:47380566-47380588 TGGGACGAGGCTAGGCAACATGG No data
1184891208_1184891216 18 Left 1184891208 22:47380517-47380539 CCAGCACTTTGGGAGGCTGAGGC No data
Right 1184891216 22:47380558-47380580 TAGGAGTTTGGGACGAGGCTAGG No data
1184891208_1184891212 -1 Left 1184891208 22:47380517-47380539 CCAGCACTTTGGGAGGCTGAGGC No data
Right 1184891212 22:47380539-47380561 CAGGCAGGTCACTTGAGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184891208 Original CRISPR GCCTCAGCCTCCCAAAGTGC TGG (reversed) Intergenic