ID: 1184891209

View in Genome Browser
Species Human (GRCh38)
Location 22:47380520-47380542
Sequence GCACTTTGGGAGGCTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1032626
Summary {0: 59629, 1: 175979, 2: 229415, 3: 270535, 4: 297068}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184891201_1184891209 -5 Left 1184891201 22:47380502-47380524 CCCATACCTGTAATTCCAGCACT No data
Right 1184891209 22:47380520-47380542 GCACTTTGGGAGGCTGAGGCAGG 0: 59629
1: 175979
2: 229415
3: 270535
4: 297068
1184891200_1184891209 8 Left 1184891200 22:47380489-47380511 CCAGGCGTGGTGGCCCATACCTG 0: 7
1: 782
2: 21274
3: 99378
4: 211413
Right 1184891209 22:47380520-47380542 GCACTTTGGGAGGCTGAGGCAGG 0: 59629
1: 175979
2: 229415
3: 270535
4: 297068
1184891202_1184891209 -6 Left 1184891202 22:47380503-47380525 CCATACCTGTAATTCCAGCACTT No data
Right 1184891209 22:47380520-47380542 GCACTTTGGGAGGCTGAGGCAGG 0: 59629
1: 175979
2: 229415
3: 270535
4: 297068

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184891209 Original CRISPR GCACTTTGGGAGGCTGAGGC AGG Intergenic
Too many off-targets to display for this crispr