ID: 1184891210

View in Genome Browser
Species Human (GRCh38)
Location 22:47380524-47380546
Sequence TTTGGGAGGCTGAGGCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 19627
Summary {0: 375, 1: 1663, 2: 3864, 3: 6052, 4: 7673}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184891201_1184891210 -1 Left 1184891201 22:47380502-47380524 CCCATACCTGTAATTCCAGCACT No data
Right 1184891210 22:47380524-47380546 TTTGGGAGGCTGAGGCAGGCAGG 0: 375
1: 1663
2: 3864
3: 6052
4: 7673
1184891202_1184891210 -2 Left 1184891202 22:47380503-47380525 CCATACCTGTAATTCCAGCACTT No data
Right 1184891210 22:47380524-47380546 TTTGGGAGGCTGAGGCAGGCAGG 0: 375
1: 1663
2: 3864
3: 6052
4: 7673
1184891200_1184891210 12 Left 1184891200 22:47380489-47380511 CCAGGCGTGGTGGCCCATACCTG 0: 7
1: 782
2: 21274
3: 99378
4: 211413
Right 1184891210 22:47380524-47380546 TTTGGGAGGCTGAGGCAGGCAGG 0: 375
1: 1663
2: 3864
3: 6052
4: 7673
1184891205_1184891210 -7 Left 1184891205 22:47380508-47380530 CCTGTAATTCCAGCACTTTGGGA 0: 11218
1: 302003
2: 259881
3: 147035
4: 132604
Right 1184891210 22:47380524-47380546 TTTGGGAGGCTGAGGCAGGCAGG 0: 375
1: 1663
2: 3864
3: 6052
4: 7673

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184891210 Original CRISPR TTTGGGAGGCTGAGGCAGGC AGG Intergenic
Too many off-targets to display for this crispr