ID: 1184891210

View in Genome Browser
Species Human (GRCh38)
Location 22:47380524-47380546
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184891200_1184891210 12 Left 1184891200 22:47380489-47380511 CCAGGCGTGGTGGCCCATACCTG No data
Right 1184891210 22:47380524-47380546 TTTGGGAGGCTGAGGCAGGCAGG No data
1184891205_1184891210 -7 Left 1184891205 22:47380508-47380530 CCTGTAATTCCAGCACTTTGGGA No data
Right 1184891210 22:47380524-47380546 TTTGGGAGGCTGAGGCAGGCAGG No data
1184891201_1184891210 -1 Left 1184891201 22:47380502-47380524 CCCATACCTGTAATTCCAGCACT No data
Right 1184891210 22:47380524-47380546 TTTGGGAGGCTGAGGCAGGCAGG No data
1184891202_1184891210 -2 Left 1184891202 22:47380503-47380525 CCATACCTGTAATTCCAGCACTT No data
Right 1184891210 22:47380524-47380546 TTTGGGAGGCTGAGGCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184891210 Original CRISPR TTTGGGAGGCTGAGGCAGGC AGG Intergenic