ID: 1184891211

View in Genome Browser
Species Human (GRCh38)
Location 22:47380534-47380556
Sequence TGAGGCAGGCAGGTCACTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184891202_1184891211 8 Left 1184891202 22:47380503-47380525 CCATACCTGTAATTCCAGCACTT No data
Right 1184891211 22:47380534-47380556 TGAGGCAGGCAGGTCACTTGAGG No data
1184891200_1184891211 22 Left 1184891200 22:47380489-47380511 CCAGGCGTGGTGGCCCATACCTG No data
Right 1184891211 22:47380534-47380556 TGAGGCAGGCAGGTCACTTGAGG No data
1184891205_1184891211 3 Left 1184891205 22:47380508-47380530 CCTGTAATTCCAGCACTTTGGGA No data
Right 1184891211 22:47380534-47380556 TGAGGCAGGCAGGTCACTTGAGG No data
1184891208_1184891211 -6 Left 1184891208 22:47380517-47380539 CCAGCACTTTGGGAGGCTGAGGC No data
Right 1184891211 22:47380534-47380556 TGAGGCAGGCAGGTCACTTGAGG No data
1184891201_1184891211 9 Left 1184891201 22:47380502-47380524 CCCATACCTGTAATTCCAGCACT No data
Right 1184891211 22:47380534-47380556 TGAGGCAGGCAGGTCACTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184891211 Original CRISPR TGAGGCAGGCAGGTCACTTG AGG Intergenic