ID: 1184891211

View in Genome Browser
Species Human (GRCh38)
Location 22:47380534-47380556
Sequence TGAGGCAGGCAGGTCACTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104639
Summary {0: 59, 1: 2382, 2: 10833, 3: 30969, 4: 60396}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184891208_1184891211 -6 Left 1184891208 22:47380517-47380539 CCAGCACTTTGGGAGGCTGAGGC 0: 56931
1: 168651
2: 218048
3: 269456
4: 306914
Right 1184891211 22:47380534-47380556 TGAGGCAGGCAGGTCACTTGAGG 0: 59
1: 2382
2: 10833
3: 30969
4: 60396
1184891201_1184891211 9 Left 1184891201 22:47380502-47380524 CCCATACCTGTAATTCCAGCACT No data
Right 1184891211 22:47380534-47380556 TGAGGCAGGCAGGTCACTTGAGG 0: 59
1: 2382
2: 10833
3: 30969
4: 60396
1184891202_1184891211 8 Left 1184891202 22:47380503-47380525 CCATACCTGTAATTCCAGCACTT No data
Right 1184891211 22:47380534-47380556 TGAGGCAGGCAGGTCACTTGAGG 0: 59
1: 2382
2: 10833
3: 30969
4: 60396
1184891200_1184891211 22 Left 1184891200 22:47380489-47380511 CCAGGCGTGGTGGCCCATACCTG 0: 7
1: 782
2: 21274
3: 99378
4: 211413
Right 1184891211 22:47380534-47380556 TGAGGCAGGCAGGTCACTTGAGG 0: 59
1: 2382
2: 10833
3: 30969
4: 60396
1184891205_1184891211 3 Left 1184891205 22:47380508-47380530 CCTGTAATTCCAGCACTTTGGGA 0: 11218
1: 302003
2: 259881
3: 147035
4: 132604
Right 1184891211 22:47380534-47380556 TGAGGCAGGCAGGTCACTTGAGG 0: 59
1: 2382
2: 10833
3: 30969
4: 60396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184891211 Original CRISPR TGAGGCAGGCAGGTCACTTG AGG Intergenic
Too many off-targets to display for this crispr