ID: 1184891212

View in Genome Browser
Species Human (GRCh38)
Location 22:47380539-47380561
Sequence CAGGCAGGTCACTTGAGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184891205_1184891212 8 Left 1184891205 22:47380508-47380530 CCTGTAATTCCAGCACTTTGGGA No data
Right 1184891212 22:47380539-47380561 CAGGCAGGTCACTTGAGGCTAGG No data
1184891201_1184891212 14 Left 1184891201 22:47380502-47380524 CCCATACCTGTAATTCCAGCACT No data
Right 1184891212 22:47380539-47380561 CAGGCAGGTCACTTGAGGCTAGG No data
1184891202_1184891212 13 Left 1184891202 22:47380503-47380525 CCATACCTGTAATTCCAGCACTT No data
Right 1184891212 22:47380539-47380561 CAGGCAGGTCACTTGAGGCTAGG No data
1184891208_1184891212 -1 Left 1184891208 22:47380517-47380539 CCAGCACTTTGGGAGGCTGAGGC No data
Right 1184891212 22:47380539-47380561 CAGGCAGGTCACTTGAGGCTAGG No data
1184891200_1184891212 27 Left 1184891200 22:47380489-47380511 CCAGGCGTGGTGGCCCATACCTG No data
Right 1184891212 22:47380539-47380561 CAGGCAGGTCACTTGAGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184891212 Original CRISPR CAGGCAGGTCACTTGAGGCT AGG Intergenic