ID: 1184891214

View in Genome Browser
Species Human (GRCh38)
Location 22:47380547-47380569
Sequence TCACTTGAGGCTAGGAGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184891205_1184891214 16 Left 1184891205 22:47380508-47380530 CCTGTAATTCCAGCACTTTGGGA 0: 11218
1: 302003
2: 259881
3: 147035
4: 132604
Right 1184891214 22:47380547-47380569 TCACTTGAGGCTAGGAGTTTGGG No data
1184891202_1184891214 21 Left 1184891202 22:47380503-47380525 CCATACCTGTAATTCCAGCACTT No data
Right 1184891214 22:47380547-47380569 TCACTTGAGGCTAGGAGTTTGGG No data
1184891201_1184891214 22 Left 1184891201 22:47380502-47380524 CCCATACCTGTAATTCCAGCACT No data
Right 1184891214 22:47380547-47380569 TCACTTGAGGCTAGGAGTTTGGG No data
1184891208_1184891214 7 Left 1184891208 22:47380517-47380539 CCAGCACTTTGGGAGGCTGAGGC 0: 56931
1: 168651
2: 218048
3: 269456
4: 306914
Right 1184891214 22:47380547-47380569 TCACTTGAGGCTAGGAGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184891214 Original CRISPR TCACTTGAGGCTAGGAGTTT GGG Intergenic
No off target data available for this crispr