ID: 1184892819

View in Genome Browser
Species Human (GRCh38)
Location 22:47389985-47390007
Sequence TGGCTGTACTTTACTCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184892819_1184892835 30 Left 1184892819 22:47389985-47390007 CCAAGATGAGTAAAGTACAGCCA No data
Right 1184892835 22:47390038-47390060 ACCCACTGACTGCCCGGGGAGGG No data
1184892819_1184892832 25 Left 1184892819 22:47389985-47390007 CCAAGATGAGTAAAGTACAGCCA No data
Right 1184892832 22:47390033-47390055 CGCACACCCACTGACTGCCCGGG No data
1184892819_1184892821 -9 Left 1184892819 22:47389985-47390007 CCAAGATGAGTAAAGTACAGCCA No data
Right 1184892821 22:47389999-47390021 GTACAGCCACCTCCCCCAGGAGG No data
1184892819_1184892831 24 Left 1184892819 22:47389985-47390007 CCAAGATGAGTAAAGTACAGCCA No data
Right 1184892831 22:47390032-47390054 ACGCACACCCACTGACTGCCCGG No data
1184892819_1184892833 26 Left 1184892819 22:47389985-47390007 CCAAGATGAGTAAAGTACAGCCA No data
Right 1184892833 22:47390034-47390056 GCACACCCACTGACTGCCCGGGG No data
1184892819_1184892834 29 Left 1184892819 22:47389985-47390007 CCAAGATGAGTAAAGTACAGCCA No data
Right 1184892834 22:47390037-47390059 CACCCACTGACTGCCCGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184892819 Original CRISPR TGGCTGTACTTTACTCATCT TGG (reversed) Intergenic
No off target data available for this crispr