ID: 1184892824

View in Genome Browser
Species Human (GRCh38)
Location 22:47390011-47390033
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184892824_1184892834 3 Left 1184892824 22:47390011-47390033 CCCCCAGGAGGACCCAGCTCCAC No data
Right 1184892834 22:47390037-47390059 CACCCACTGACTGCCCGGGGAGG No data
1184892824_1184892844 26 Left 1184892824 22:47390011-47390033 CCCCCAGGAGGACCCAGCTCCAC No data
Right 1184892844 22:47390060-47390082 GGGGCAGGCAGCCAGTCCCAAGG No data
1184892824_1184892837 5 Left 1184892824 22:47390011-47390033 CCCCCAGGAGGACCCAGCTCCAC No data
Right 1184892837 22:47390039-47390061 CCCACTGACTGCCCGGGGAGGGG No data
1184892824_1184892841 11 Left 1184892824 22:47390011-47390033 CCCCCAGGAGGACCCAGCTCCAC No data
Right 1184892841 22:47390045-47390067 GACTGCCCGGGGAGGGGGGCAGG No data
1184892824_1184892835 4 Left 1184892824 22:47390011-47390033 CCCCCAGGAGGACCCAGCTCCAC No data
Right 1184892835 22:47390038-47390060 ACCCACTGACTGCCCGGGGAGGG No data
1184892824_1184892839 6 Left 1184892824 22:47390011-47390033 CCCCCAGGAGGACCCAGCTCCAC No data
Right 1184892839 22:47390040-47390062 CCACTGACTGCCCGGGGAGGGGG No data
1184892824_1184892840 7 Left 1184892824 22:47390011-47390033 CCCCCAGGAGGACCCAGCTCCAC No data
Right 1184892840 22:47390041-47390063 CACTGACTGCCCGGGGAGGGGGG No data
1184892824_1184892833 0 Left 1184892824 22:47390011-47390033 CCCCCAGGAGGACCCAGCTCCAC No data
Right 1184892833 22:47390034-47390056 GCACACCCACTGACTGCCCGGGG No data
1184892824_1184892831 -2 Left 1184892824 22:47390011-47390033 CCCCCAGGAGGACCCAGCTCCAC No data
Right 1184892831 22:47390032-47390054 ACGCACACCCACTGACTGCCCGG No data
1184892824_1184892832 -1 Left 1184892824 22:47390011-47390033 CCCCCAGGAGGACCCAGCTCCAC No data
Right 1184892832 22:47390033-47390055 CGCACACCCACTGACTGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184892824 Original CRISPR GTGGAGCTGGGTCCTCCTGG GGG (reversed) Intergenic
No off target data available for this crispr