ID: 1184892826

View in Genome Browser
Species Human (GRCh38)
Location 22:47390013-47390035
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184892826_1184892831 -4 Left 1184892826 22:47390013-47390035 CCCAGGAGGACCCAGCTCCACGC No data
Right 1184892831 22:47390032-47390054 ACGCACACCCACTGACTGCCCGG No data
1184892826_1184892835 2 Left 1184892826 22:47390013-47390035 CCCAGGAGGACCCAGCTCCACGC No data
Right 1184892835 22:47390038-47390060 ACCCACTGACTGCCCGGGGAGGG No data
1184892826_1184892837 3 Left 1184892826 22:47390013-47390035 CCCAGGAGGACCCAGCTCCACGC No data
Right 1184892837 22:47390039-47390061 CCCACTGACTGCCCGGGGAGGGG No data
1184892826_1184892834 1 Left 1184892826 22:47390013-47390035 CCCAGGAGGACCCAGCTCCACGC No data
Right 1184892834 22:47390037-47390059 CACCCACTGACTGCCCGGGGAGG No data
1184892826_1184892833 -2 Left 1184892826 22:47390013-47390035 CCCAGGAGGACCCAGCTCCACGC No data
Right 1184892833 22:47390034-47390056 GCACACCCACTGACTGCCCGGGG No data
1184892826_1184892839 4 Left 1184892826 22:47390013-47390035 CCCAGGAGGACCCAGCTCCACGC No data
Right 1184892839 22:47390040-47390062 CCACTGACTGCCCGGGGAGGGGG No data
1184892826_1184892841 9 Left 1184892826 22:47390013-47390035 CCCAGGAGGACCCAGCTCCACGC No data
Right 1184892841 22:47390045-47390067 GACTGCCCGGGGAGGGGGGCAGG No data
1184892826_1184892840 5 Left 1184892826 22:47390013-47390035 CCCAGGAGGACCCAGCTCCACGC No data
Right 1184892840 22:47390041-47390063 CACTGACTGCCCGGGGAGGGGGG No data
1184892826_1184892832 -3 Left 1184892826 22:47390013-47390035 CCCAGGAGGACCCAGCTCCACGC No data
Right 1184892832 22:47390033-47390055 CGCACACCCACTGACTGCCCGGG No data
1184892826_1184892844 24 Left 1184892826 22:47390013-47390035 CCCAGGAGGACCCAGCTCCACGC No data
Right 1184892844 22:47390060-47390082 GGGGCAGGCAGCCAGTCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184892826 Original CRISPR GCGTGGAGCTGGGTCCTCCT GGG (reversed) Intergenic