ID: 1184892828

View in Genome Browser
Species Human (GRCh38)
Location 22:47390023-47390045
Sequence CAGTGGGTGTGCGTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184892828_1184892835 -8 Left 1184892828 22:47390023-47390045 CCCAGCTCCACGCACACCCACTG No data
Right 1184892835 22:47390038-47390060 ACCCACTGACTGCCCGGGGAGGG No data
1184892828_1184892840 -5 Left 1184892828 22:47390023-47390045 CCCAGCTCCACGCACACCCACTG No data
Right 1184892840 22:47390041-47390063 CACTGACTGCCCGGGGAGGGGGG No data
1184892828_1184892839 -6 Left 1184892828 22:47390023-47390045 CCCAGCTCCACGCACACCCACTG No data
Right 1184892839 22:47390040-47390062 CCACTGACTGCCCGGGGAGGGGG No data
1184892828_1184892844 14 Left 1184892828 22:47390023-47390045 CCCAGCTCCACGCACACCCACTG No data
Right 1184892844 22:47390060-47390082 GGGGCAGGCAGCCAGTCCCAAGG No data
1184892828_1184892841 -1 Left 1184892828 22:47390023-47390045 CCCAGCTCCACGCACACCCACTG No data
Right 1184892841 22:47390045-47390067 GACTGCCCGGGGAGGGGGGCAGG No data
1184892828_1184892837 -7 Left 1184892828 22:47390023-47390045 CCCAGCTCCACGCACACCCACTG No data
Right 1184892837 22:47390039-47390061 CCCACTGACTGCCCGGGGAGGGG No data
1184892828_1184892834 -9 Left 1184892828 22:47390023-47390045 CCCAGCTCCACGCACACCCACTG No data
Right 1184892834 22:47390037-47390059 CACCCACTGACTGCCCGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184892828 Original CRISPR CAGTGGGTGTGCGTGGAGCT GGG (reversed) Intergenic