ID: 1184892831

View in Genome Browser
Species Human (GRCh38)
Location 22:47390032-47390054
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184892823_1184892831 1 Left 1184892823 22:47390008-47390030 CCTCCCCCAGGAGGACCCAGCTC No data
Right 1184892831 22:47390032-47390054 ACGCACACCCACTGACTGCCCGG No data
1184892826_1184892831 -4 Left 1184892826 22:47390013-47390035 CCCAGGAGGACCCAGCTCCACGC No data
Right 1184892831 22:47390032-47390054 ACGCACACCCACTGACTGCCCGG No data
1184892824_1184892831 -2 Left 1184892824 22:47390011-47390033 CCCCCAGGAGGACCCAGCTCCAC No data
Right 1184892831 22:47390032-47390054 ACGCACACCCACTGACTGCCCGG No data
1184892827_1184892831 -5 Left 1184892827 22:47390014-47390036 CCAGGAGGACCCAGCTCCACGCA No data
Right 1184892831 22:47390032-47390054 ACGCACACCCACTGACTGCCCGG No data
1184892819_1184892831 24 Left 1184892819 22:47389985-47390007 CCAAGATGAGTAAAGTACAGCCA No data
Right 1184892831 22:47390032-47390054 ACGCACACCCACTGACTGCCCGG No data
1184892822_1184892831 4 Left 1184892822 22:47390005-47390027 CCACCTCCCCCAGGAGGACCCAG No data
Right 1184892831 22:47390032-47390054 ACGCACACCCACTGACTGCCCGG No data
1184892825_1184892831 -3 Left 1184892825 22:47390012-47390034 CCCCAGGAGGACCCAGCTCCACG No data
Right 1184892831 22:47390032-47390054 ACGCACACCCACTGACTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184892831 Original CRISPR ACGCACACCCACTGACTGCC CGG Intergenic