ID: 1184892840

View in Genome Browser
Species Human (GRCh38)
Location 22:47390041-47390063
Sequence CACTGACTGCCCGGGGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184892828_1184892840 -5 Left 1184892828 22:47390023-47390045 CCCAGCTCCACGCACACCCACTG No data
Right 1184892840 22:47390041-47390063 CACTGACTGCCCGGGGAGGGGGG No data
1184892826_1184892840 5 Left 1184892826 22:47390013-47390035 CCCAGGAGGACCCAGCTCCACGC No data
Right 1184892840 22:47390041-47390063 CACTGACTGCCCGGGGAGGGGGG No data
1184892822_1184892840 13 Left 1184892822 22:47390005-47390027 CCACCTCCCCCAGGAGGACCCAG No data
Right 1184892840 22:47390041-47390063 CACTGACTGCCCGGGGAGGGGGG No data
1184892827_1184892840 4 Left 1184892827 22:47390014-47390036 CCAGGAGGACCCAGCTCCACGCA No data
Right 1184892840 22:47390041-47390063 CACTGACTGCCCGGGGAGGGGGG No data
1184892829_1184892840 -6 Left 1184892829 22:47390024-47390046 CCAGCTCCACGCACACCCACTGA No data
Right 1184892840 22:47390041-47390063 CACTGACTGCCCGGGGAGGGGGG No data
1184892824_1184892840 7 Left 1184892824 22:47390011-47390033 CCCCCAGGAGGACCCAGCTCCAC No data
Right 1184892840 22:47390041-47390063 CACTGACTGCCCGGGGAGGGGGG No data
1184892823_1184892840 10 Left 1184892823 22:47390008-47390030 CCTCCCCCAGGAGGACCCAGCTC No data
Right 1184892840 22:47390041-47390063 CACTGACTGCCCGGGGAGGGGGG No data
1184892825_1184892840 6 Left 1184892825 22:47390012-47390034 CCCCAGGAGGACCCAGCTCCACG No data
Right 1184892840 22:47390041-47390063 CACTGACTGCCCGGGGAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184892840 Original CRISPR CACTGACTGCCCGGGGAGGG GGG Intergenic
No off target data available for this crispr