ID: 1184892841

View in Genome Browser
Species Human (GRCh38)
Location 22:47390045-47390067
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184892830_1184892841 -8 Left 1184892830 22:47390030-47390052 CCACGCACACCCACTGACTGCCC No data
Right 1184892841 22:47390045-47390067 GACTGCCCGGGGAGGGGGGCAGG No data
1184892822_1184892841 17 Left 1184892822 22:47390005-47390027 CCACCTCCCCCAGGAGGACCCAG No data
Right 1184892841 22:47390045-47390067 GACTGCCCGGGGAGGGGGGCAGG No data
1184892828_1184892841 -1 Left 1184892828 22:47390023-47390045 CCCAGCTCCACGCACACCCACTG No data
Right 1184892841 22:47390045-47390067 GACTGCCCGGGGAGGGGGGCAGG No data
1184892827_1184892841 8 Left 1184892827 22:47390014-47390036 CCAGGAGGACCCAGCTCCACGCA No data
Right 1184892841 22:47390045-47390067 GACTGCCCGGGGAGGGGGGCAGG No data
1184892823_1184892841 14 Left 1184892823 22:47390008-47390030 CCTCCCCCAGGAGGACCCAGCTC No data
Right 1184892841 22:47390045-47390067 GACTGCCCGGGGAGGGGGGCAGG No data
1184892826_1184892841 9 Left 1184892826 22:47390013-47390035 CCCAGGAGGACCCAGCTCCACGC No data
Right 1184892841 22:47390045-47390067 GACTGCCCGGGGAGGGGGGCAGG No data
1184892829_1184892841 -2 Left 1184892829 22:47390024-47390046 CCAGCTCCACGCACACCCACTGA No data
Right 1184892841 22:47390045-47390067 GACTGCCCGGGGAGGGGGGCAGG No data
1184892825_1184892841 10 Left 1184892825 22:47390012-47390034 CCCCAGGAGGACCCAGCTCCACG No data
Right 1184892841 22:47390045-47390067 GACTGCCCGGGGAGGGGGGCAGG No data
1184892824_1184892841 11 Left 1184892824 22:47390011-47390033 CCCCCAGGAGGACCCAGCTCCAC No data
Right 1184892841 22:47390045-47390067 GACTGCCCGGGGAGGGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184892841 Original CRISPR GACTGCCCGGGGAGGGGGGC AGG Intergenic