ID: 1184895073

View in Genome Browser
Species Human (GRCh38)
Location 22:47401903-47401925
Sequence TGTCCAATCTTTATAGTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184895073_1184895077 22 Left 1184895073 22:47401903-47401925 CCACTCACTATAAAGATTGGACA No data
Right 1184895077 22:47401948-47401970 CTGAATGGCTGTAATAAGATAGG No data
1184895073_1184895076 7 Left 1184895073 22:47401903-47401925 CCACTCACTATAAAGATTGGACA No data
Right 1184895076 22:47401933-47401955 ACATTTATTAGCTAACTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184895073 Original CRISPR TGTCCAATCTTTATAGTGAG TGG (reversed) Intergenic
No off target data available for this crispr