ID: 1184896720

View in Genome Browser
Species Human (GRCh38)
Location 22:47411867-47411889
Sequence TGAAAACTACATCACTTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184896718_1184896720 -2 Left 1184896718 22:47411846-47411868 CCCAAATTGAACATCTAGAGATG No data
Right 1184896720 22:47411867-47411889 TGAAAACTACATCACTTGAGAGG No data
1184896719_1184896720 -3 Left 1184896719 22:47411847-47411869 CCAAATTGAACATCTAGAGATGA No data
Right 1184896720 22:47411867-47411889 TGAAAACTACATCACTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184896720 Original CRISPR TGAAAACTACATCACTTGAG AGG Intergenic
No off target data available for this crispr