ID: 1184897853

View in Genome Browser
Species Human (GRCh38)
Location 22:47422500-47422522
Sequence CCAGTTTTGCAGGCTGCGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184897844_1184897853 24 Left 1184897844 22:47422453-47422475 CCAGTGGTTTGCTCTGTGTCATC No data
Right 1184897853 22:47422500-47422522 CCAGTTTTGCAGGCTGCGTATGG No data
1184897848_1184897853 2 Left 1184897848 22:47422475-47422497 CCAGGTGGTAGCTGGAATTAGAA No data
Right 1184897853 22:47422500-47422522 CCAGTTTTGCAGGCTGCGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184897853 Original CRISPR CCAGTTTTGCAGGCTGCGTA TGG Intergenic
No off target data available for this crispr