ID: 1184897930

View in Genome Browser
Species Human (GRCh38)
Location 22:47422953-47422975
Sequence TTGGTCCGCAGTGGCTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184897930_1184897934 -3 Left 1184897930 22:47422953-47422975 CCTGGCCAGCCACTGCGGACCAA No data
Right 1184897934 22:47422973-47422995 CAACGTGCAGCTTCCTCGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184897930 Original CRISPR TTGGTCCGCAGTGGCTGGCC AGG (reversed) Intergenic