ID: 1184900189

View in Genome Browser
Species Human (GRCh38)
Location 22:47441806-47441828
Sequence TTATGCAGCTTACAAAATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184900188_1184900189 2 Left 1184900188 22:47441781-47441803 CCAGCAATAGTGAGATGCAGGCT No data
Right 1184900189 22:47441806-47441828 TTATGCAGCTTACAAAATACAGG No data
1184900185_1184900189 20 Left 1184900185 22:47441763-47441785 CCAGGGCTTCCAGGAAGACCAGC No data
Right 1184900189 22:47441806-47441828 TTATGCAGCTTACAAAATACAGG No data
1184900184_1184900189 21 Left 1184900184 22:47441762-47441784 CCCAGGGCTTCCAGGAAGACCAG No data
Right 1184900189 22:47441806-47441828 TTATGCAGCTTACAAAATACAGG No data
1184900186_1184900189 11 Left 1184900186 22:47441772-47441794 CCAGGAAGACCAGCAATAGTGAG No data
Right 1184900189 22:47441806-47441828 TTATGCAGCTTACAAAATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184900189 Original CRISPR TTATGCAGCTTACAAAATAC AGG Intergenic
No off target data available for this crispr