ID: 1184901630

View in Genome Browser
Species Human (GRCh38)
Location 22:47449953-47449975
Sequence GTGAGAGAGACTAAACCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184901630_1184901637 13 Left 1184901630 22:47449953-47449975 CCAGCAGGTTTAGTCTCTCTCAC No data
Right 1184901637 22:47449989-47450011 GAAAACGCTTGTGATTATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184901630 Original CRISPR GTGAGAGAGACTAAACCTGC TGG (reversed) Intergenic
No off target data available for this crispr