ID: 1184902895

View in Genome Browser
Species Human (GRCh38)
Location 22:47458512-47458534
Sequence CTTCTGCAGATGGGGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184902895_1184902907 18 Left 1184902895 22:47458512-47458534 CCTCCCAGCCCCATCTGCAGAAG No data
Right 1184902907 22:47458553-47458575 CCAGAAAAGTGGGCTTGAAGTGG No data
1184902895_1184902908 19 Left 1184902895 22:47458512-47458534 CCTCCCAGCCCCATCTGCAGAAG No data
Right 1184902908 22:47458554-47458576 CAGAAAAGTGGGCTTGAAGTGGG No data
1184902895_1184902904 8 Left 1184902895 22:47458512-47458534 CCTCCCAGCCCCATCTGCAGAAG No data
Right 1184902904 22:47458543-47458565 CGGCCAGAATCCAGAAAAGTGGG No data
1184902895_1184902903 7 Left 1184902895 22:47458512-47458534 CCTCCCAGCCCCATCTGCAGAAG No data
Right 1184902903 22:47458542-47458564 ACGGCCAGAATCCAGAAAAGTGG No data
1184902895_1184902909 26 Left 1184902895 22:47458512-47458534 CCTCCCAGCCCCATCTGCAGAAG No data
Right 1184902909 22:47458561-47458583 GTGGGCTTGAAGTGGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184902895 Original CRISPR CTTCTGCAGATGGGGCTGGG AGG (reversed) Intergenic
No off target data available for this crispr