ID: 1184902897

View in Genome Browser
Species Human (GRCh38)
Location 22:47458516-47458538
Sequence GCTGCTTCTGCAGATGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184902897_1184902903 3 Left 1184902897 22:47458516-47458538 CCAGCCCCATCTGCAGAAGCAGC No data
Right 1184902903 22:47458542-47458564 ACGGCCAGAATCCAGAAAAGTGG No data
1184902897_1184902907 14 Left 1184902897 22:47458516-47458538 CCAGCCCCATCTGCAGAAGCAGC No data
Right 1184902907 22:47458553-47458575 CCAGAAAAGTGGGCTTGAAGTGG No data
1184902897_1184902909 22 Left 1184902897 22:47458516-47458538 CCAGCCCCATCTGCAGAAGCAGC No data
Right 1184902909 22:47458561-47458583 GTGGGCTTGAAGTGGGAGCTTGG No data
1184902897_1184902904 4 Left 1184902897 22:47458516-47458538 CCAGCCCCATCTGCAGAAGCAGC No data
Right 1184902904 22:47458543-47458565 CGGCCAGAATCCAGAAAAGTGGG No data
1184902897_1184902908 15 Left 1184902897 22:47458516-47458538 CCAGCCCCATCTGCAGAAGCAGC No data
Right 1184902908 22:47458554-47458576 CAGAAAAGTGGGCTTGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184902897 Original CRISPR GCTGCTTCTGCAGATGGGGC TGG (reversed) Intergenic
No off target data available for this crispr