ID: 1184902898

View in Genome Browser
Species Human (GRCh38)
Location 22:47458520-47458542
Sequence TGGCGCTGCTTCTGCAGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184902898_1184902904 0 Left 1184902898 22:47458520-47458542 CCCCATCTGCAGAAGCAGCGCCA No data
Right 1184902904 22:47458543-47458565 CGGCCAGAATCCAGAAAAGTGGG No data
1184902898_1184902909 18 Left 1184902898 22:47458520-47458542 CCCCATCTGCAGAAGCAGCGCCA No data
Right 1184902909 22:47458561-47458583 GTGGGCTTGAAGTGGGAGCTTGG No data
1184902898_1184902907 10 Left 1184902898 22:47458520-47458542 CCCCATCTGCAGAAGCAGCGCCA No data
Right 1184902907 22:47458553-47458575 CCAGAAAAGTGGGCTTGAAGTGG No data
1184902898_1184902910 28 Left 1184902898 22:47458520-47458542 CCCCATCTGCAGAAGCAGCGCCA No data
Right 1184902910 22:47458571-47458593 AGTGGGAGCTTGGACAGCCCTGG No data
1184902898_1184902911 29 Left 1184902898 22:47458520-47458542 CCCCATCTGCAGAAGCAGCGCCA No data
Right 1184902911 22:47458572-47458594 GTGGGAGCTTGGACAGCCCTGGG No data
1184902898_1184902903 -1 Left 1184902898 22:47458520-47458542 CCCCATCTGCAGAAGCAGCGCCA No data
Right 1184902903 22:47458542-47458564 ACGGCCAGAATCCAGAAAAGTGG No data
1184902898_1184902908 11 Left 1184902898 22:47458520-47458542 CCCCATCTGCAGAAGCAGCGCCA No data
Right 1184902908 22:47458554-47458576 CAGAAAAGTGGGCTTGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184902898 Original CRISPR TGGCGCTGCTTCTGCAGATG GGG (reversed) Intergenic
No off target data available for this crispr