ID: 1184902902

View in Genome Browser
Species Human (GRCh38)
Location 22:47458540-47458562
Sequence ACTTTTCTGGATTCTGGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184902902_1184902915 26 Left 1184902902 22:47458540-47458562 CCACGGCCAGAATCCAGAAAAGT No data
Right 1184902915 22:47458589-47458611 CCTGGGCAGGCAGTACCTTGAGG No data
1184902902_1184902910 8 Left 1184902902 22:47458540-47458562 CCACGGCCAGAATCCAGAAAAGT No data
Right 1184902910 22:47458571-47458593 AGTGGGAGCTTGGACAGCCCTGG No data
1184902902_1184902912 13 Left 1184902902 22:47458540-47458562 CCACGGCCAGAATCCAGAAAAGT No data
Right 1184902912 22:47458576-47458598 GAGCTTGGACAGCCCTGGGCAGG No data
1184902902_1184902908 -9 Left 1184902902 22:47458540-47458562 CCACGGCCAGAATCCAGAAAAGT No data
Right 1184902908 22:47458554-47458576 CAGAAAAGTGGGCTTGAAGTGGG No data
1184902902_1184902909 -2 Left 1184902902 22:47458540-47458562 CCACGGCCAGAATCCAGAAAAGT No data
Right 1184902909 22:47458561-47458583 GTGGGCTTGAAGTGGGAGCTTGG No data
1184902902_1184902911 9 Left 1184902902 22:47458540-47458562 CCACGGCCAGAATCCAGAAAAGT No data
Right 1184902911 22:47458572-47458594 GTGGGAGCTTGGACAGCCCTGGG No data
1184902902_1184902907 -10 Left 1184902902 22:47458540-47458562 CCACGGCCAGAATCCAGAAAAGT No data
Right 1184902907 22:47458553-47458575 CCAGAAAAGTGGGCTTGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184902902 Original CRISPR ACTTTTCTGGATTCTGGCCG TGG (reversed) Intergenic
No off target data available for this crispr