ID: 1184902904

View in Genome Browser
Species Human (GRCh38)
Location 22:47458543-47458565
Sequence CGGCCAGAATCCAGAAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184902897_1184902904 4 Left 1184902897 22:47458516-47458538 CCAGCCCCATCTGCAGAAGCAGC No data
Right 1184902904 22:47458543-47458565 CGGCCAGAATCCAGAAAAGTGGG No data
1184902900_1184902904 -2 Left 1184902900 22:47458522-47458544 CCATCTGCAGAAGCAGCGCCACG No data
Right 1184902904 22:47458543-47458565 CGGCCAGAATCCAGAAAAGTGGG No data
1184902899_1184902904 -1 Left 1184902899 22:47458521-47458543 CCCATCTGCAGAAGCAGCGCCAC No data
Right 1184902904 22:47458543-47458565 CGGCCAGAATCCAGAAAAGTGGG No data
1184902896_1184902904 5 Left 1184902896 22:47458515-47458537 CCCAGCCCCATCTGCAGAAGCAG No data
Right 1184902904 22:47458543-47458565 CGGCCAGAATCCAGAAAAGTGGG No data
1184902894_1184902904 11 Left 1184902894 22:47458509-47458531 CCTCCTCCCAGCCCCATCTGCAG No data
Right 1184902904 22:47458543-47458565 CGGCCAGAATCCAGAAAAGTGGG No data
1184902893_1184902904 12 Left 1184902893 22:47458508-47458530 CCCTCCTCCCAGCCCCATCTGCA No data
Right 1184902904 22:47458543-47458565 CGGCCAGAATCCAGAAAAGTGGG No data
1184902895_1184902904 8 Left 1184902895 22:47458512-47458534 CCTCCCAGCCCCATCTGCAGAAG No data
Right 1184902904 22:47458543-47458565 CGGCCAGAATCCAGAAAAGTGGG No data
1184902898_1184902904 0 Left 1184902898 22:47458520-47458542 CCCCATCTGCAGAAGCAGCGCCA No data
Right 1184902904 22:47458543-47458565 CGGCCAGAATCCAGAAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184902904 Original CRISPR CGGCCAGAATCCAGAAAAGT GGG Intergenic
No off target data available for this crispr