ID: 1184902907

View in Genome Browser
Species Human (GRCh38)
Location 22:47458553-47458575
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184902894_1184902907 21 Left 1184902894 22:47458509-47458531 CCTCCTCCCAGCCCCATCTGCAG No data
Right 1184902907 22:47458553-47458575 CCAGAAAAGTGGGCTTGAAGTGG No data
1184902893_1184902907 22 Left 1184902893 22:47458508-47458530 CCCTCCTCCCAGCCCCATCTGCA No data
Right 1184902907 22:47458553-47458575 CCAGAAAAGTGGGCTTGAAGTGG No data
1184902896_1184902907 15 Left 1184902896 22:47458515-47458537 CCCAGCCCCATCTGCAGAAGCAG No data
Right 1184902907 22:47458553-47458575 CCAGAAAAGTGGGCTTGAAGTGG No data
1184902898_1184902907 10 Left 1184902898 22:47458520-47458542 CCCCATCTGCAGAAGCAGCGCCA No data
Right 1184902907 22:47458553-47458575 CCAGAAAAGTGGGCTTGAAGTGG No data
1184902902_1184902907 -10 Left 1184902902 22:47458540-47458562 CCACGGCCAGAATCCAGAAAAGT No data
Right 1184902907 22:47458553-47458575 CCAGAAAAGTGGGCTTGAAGTGG No data
1184902897_1184902907 14 Left 1184902897 22:47458516-47458538 CCAGCCCCATCTGCAGAAGCAGC No data
Right 1184902907 22:47458553-47458575 CCAGAAAAGTGGGCTTGAAGTGG No data
1184902895_1184902907 18 Left 1184902895 22:47458512-47458534 CCTCCCAGCCCCATCTGCAGAAG No data
Right 1184902907 22:47458553-47458575 CCAGAAAAGTGGGCTTGAAGTGG No data
1184902899_1184902907 9 Left 1184902899 22:47458521-47458543 CCCATCTGCAGAAGCAGCGCCAC No data
Right 1184902907 22:47458553-47458575 CCAGAAAAGTGGGCTTGAAGTGG No data
1184902900_1184902907 8 Left 1184902900 22:47458522-47458544 CCATCTGCAGAAGCAGCGCCACG No data
Right 1184902907 22:47458553-47458575 CCAGAAAAGTGGGCTTGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184902907 Original CRISPR CCAGAAAAGTGGGCTTGAAG TGG Intergenic
No off target data available for this crispr