ID: 1184908462

View in Genome Browser
Species Human (GRCh38)
Location 22:47508967-47508989
Sequence AGGACATGGCCAACCTGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184908462_1184908464 -10 Left 1184908462 22:47508967-47508989 CCATGCCAGGTTGGCCATGTCCT No data
Right 1184908464 22:47508980-47509002 GCCATGTCCTCAGACCCCAAAGG No data
1184908462_1184908468 4 Left 1184908462 22:47508967-47508989 CCATGCCAGGTTGGCCATGTCCT No data
Right 1184908468 22:47508994-47509016 CCCCAAAGGAGAGCTCTTTGAGG No data
1184908462_1184908470 5 Left 1184908462 22:47508967-47508989 CCATGCCAGGTTGGCCATGTCCT No data
Right 1184908470 22:47508995-47509017 CCCAAAGGAGAGCTCTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184908462 Original CRISPR AGGACATGGCCAACCTGGCA TGG (reversed) Intergenic
No off target data available for this crispr