ID: 1184909899

View in Genome Browser
Species Human (GRCh38)
Location 22:47524160-47524182
Sequence ATACCCATGGGGAATATGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184909899_1184909904 17 Left 1184909899 22:47524160-47524182 CCAATCATATTCCCCATGGGTAT No data
Right 1184909904 22:47524200-47524222 AGATGATTCTGAACATTACATGG No data
1184909899_1184909905 29 Left 1184909899 22:47524160-47524182 CCAATCATATTCCCCATGGGTAT No data
Right 1184909905 22:47524212-47524234 ACATTACATGGAAGAGTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184909899 Original CRISPR ATACCCATGGGGAATATGAT TGG (reversed) Intergenic
No off target data available for this crispr