ID: 1184912844

View in Genome Browser
Species Human (GRCh38)
Location 22:47547667-47547689
Sequence CAGTGAGTAGGTATGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184912831_1184912844 19 Left 1184912831 22:47547625-47547647 CCATTGGCTCTCTGAGCCCCAGC No data
Right 1184912844 22:47547667-47547689 CAGTGAGTAGGTATGGAAGAAGG No data
1184912828_1184912844 26 Left 1184912828 22:47547618-47547640 CCGGACCCCATTGGCTCTCTGAG No data
Right 1184912844 22:47547667-47547689 CAGTGAGTAGGTATGGAAGAAGG No data
1184912827_1184912844 27 Left 1184912827 22:47547617-47547639 CCCGGACCCCATTGGCTCTCTGA No data
Right 1184912844 22:47547667-47547689 CAGTGAGTAGGTATGGAAGAAGG No data
1184912838_1184912844 -3 Left 1184912838 22:47547647-47547669 CCTGGGCAACATCCGGCCACCAG No data
Right 1184912844 22:47547667-47547689 CAGTGAGTAGGTATGGAAGAAGG No data
1184912830_1184912844 20 Left 1184912830 22:47547624-47547646 CCCATTGGCTCTCTGAGCCCCAG No data
Right 1184912844 22:47547667-47547689 CAGTGAGTAGGTATGGAAGAAGG No data
1184912835_1184912844 3 Left 1184912835 22:47547641-47547663 CCCCAGCCTGGGCAACATCCGGC No data
Right 1184912844 22:47547667-47547689 CAGTGAGTAGGTATGGAAGAAGG No data
1184912837_1184912844 1 Left 1184912837 22:47547643-47547665 CCAGCCTGGGCAACATCCGGCCA No data
Right 1184912844 22:47547667-47547689 CAGTGAGTAGGTATGGAAGAAGG No data
1184912836_1184912844 2 Left 1184912836 22:47547642-47547664 CCCAGCCTGGGCAACATCCGGCC No data
Right 1184912844 22:47547667-47547689 CAGTGAGTAGGTATGGAAGAAGG No data
1184912829_1184912844 21 Left 1184912829 22:47547623-47547645 CCCCATTGGCTCTCTGAGCCCCA No data
Right 1184912844 22:47547667-47547689 CAGTGAGTAGGTATGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184912844 Original CRISPR CAGTGAGTAGGTATGGAAGA AGG Intergenic
No off target data available for this crispr