ID: 1184915458

View in Genome Browser
Species Human (GRCh38)
Location 22:47565797-47565819
Sequence TAGGAGAGGCTTGAAGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184915452_1184915458 6 Left 1184915452 22:47565768-47565790 CCTTTGGGGACTTTGTCCAGGAG No data
Right 1184915458 22:47565797-47565819 TAGGAGAGGCTTGAAGAGGTAGG No data
1184915456_1184915458 -10 Left 1184915456 22:47565784-47565806 CCAGGAGCTGTGGTAGGAGAGGC No data
Right 1184915458 22:47565797-47565819 TAGGAGAGGCTTGAAGAGGTAGG No data
1184915451_1184915458 7 Left 1184915451 22:47565767-47565789 CCCTTTGGGGACTTTGTCCAGGA No data
Right 1184915458 22:47565797-47565819 TAGGAGAGGCTTGAAGAGGTAGG No data
1184915447_1184915458 21 Left 1184915447 22:47565753-47565775 CCGTAGATGTGTTTCCCTTTGGG No data
Right 1184915458 22:47565797-47565819 TAGGAGAGGCTTGAAGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184915458 Original CRISPR TAGGAGAGGCTTGAAGAGGT AGG Intergenic
No off target data available for this crispr