ID: 1184919164

View in Genome Browser
Species Human (GRCh38)
Location 22:47593533-47593555
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184919164_1184919175 21 Left 1184919164 22:47593533-47593555 CCTCCCTCCCCTCTCTGGCTCTT No data
Right 1184919175 22:47593577-47593599 CCCTTGGCTTGTGCCATGAGCGG No data
1184919164_1184919170 -6 Left 1184919164 22:47593533-47593555 CCTCCCTCCCCTCTCTGGCTCTT No data
Right 1184919170 22:47593550-47593572 GCTCTTGCCATGTGATGCACTGG 0: 4
1: 7
2: 28
3: 87
4: 369
1184919164_1184919177 22 Left 1184919164 22:47593533-47593555 CCTCCCTCCCCTCTCTGGCTCTT No data
Right 1184919177 22:47593578-47593600 CCTTGGCTTGTGCCATGAGCGGG No data
1184919164_1184919172 5 Left 1184919164 22:47593533-47593555 CCTCCCTCCCCTCTCTGGCTCTT No data
Right 1184919172 22:47593561-47593583 GTGATGCACTGGCTTCCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184919164 Original CRISPR AAGAGCCAGAGAGGGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr