ID: 1184919165

View in Genome Browser
Species Human (GRCh38)
Location 22:47593536-47593558
Sequence GGCAAGAGCCAGAGAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184919165_1184919177 19 Left 1184919165 22:47593536-47593558 CCCTCCCCTCTCTGGCTCTTGCC No data
Right 1184919177 22:47593578-47593600 CCTTGGCTTGTGCCATGAGCGGG No data
1184919165_1184919172 2 Left 1184919165 22:47593536-47593558 CCCTCCCCTCTCTGGCTCTTGCC No data
Right 1184919172 22:47593561-47593583 GTGATGCACTGGCTTCCCCTTGG No data
1184919165_1184919175 18 Left 1184919165 22:47593536-47593558 CCCTCCCCTCTCTGGCTCTTGCC No data
Right 1184919175 22:47593577-47593599 CCCTTGGCTTGTGCCATGAGCGG No data
1184919165_1184919170 -9 Left 1184919165 22:47593536-47593558 CCCTCCCCTCTCTGGCTCTTGCC No data
Right 1184919170 22:47593550-47593572 GCTCTTGCCATGTGATGCACTGG 0: 4
1: 7
2: 28
3: 87
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184919165 Original CRISPR GGCAAGAGCCAGAGAGGGGA GGG (reversed) Intergenic
No off target data available for this crispr