ID: 1184919168

View in Genome Browser
Species Human (GRCh38)
Location 22:47593541-47593563
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184919168_1184919175 13 Left 1184919168 22:47593541-47593563 CCCTCTCTGGCTCTTGCCATGTG No data
Right 1184919175 22:47593577-47593599 CCCTTGGCTTGTGCCATGAGCGG No data
1184919168_1184919172 -3 Left 1184919168 22:47593541-47593563 CCCTCTCTGGCTCTTGCCATGTG No data
Right 1184919172 22:47593561-47593583 GTGATGCACTGGCTTCCCCTTGG No data
1184919168_1184919177 14 Left 1184919168 22:47593541-47593563 CCCTCTCTGGCTCTTGCCATGTG No data
Right 1184919177 22:47593578-47593600 CCTTGGCTTGTGCCATGAGCGGG No data
1184919168_1184919179 26 Left 1184919168 22:47593541-47593563 CCCTCTCTGGCTCTTGCCATGTG No data
Right 1184919179 22:47593590-47593612 CCATGAGCGGGAGCTCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184919168 Original CRISPR CACATGGCAAGAGCCAGAGA GGG (reversed) Intergenic
No off target data available for this crispr