ID: 1184919170

View in Genome Browser
Species Human (GRCh38)
Location 22:47593550-47593572
Sequence GCTCTTGCCATGTGATGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 495
Summary {0: 4, 1: 7, 2: 28, 3: 87, 4: 369}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184919165_1184919170 -9 Left 1184919165 22:47593536-47593558 CCCTCCCCTCTCTGGCTCTTGCC No data
Right 1184919170 22:47593550-47593572 GCTCTTGCCATGTGATGCACTGG 0: 4
1: 7
2: 28
3: 87
4: 369
1184919166_1184919170 -10 Left 1184919166 22:47593537-47593559 CCTCCCCTCTCTGGCTCTTGCCA No data
Right 1184919170 22:47593550-47593572 GCTCTTGCCATGTGATGCACTGG 0: 4
1: 7
2: 28
3: 87
4: 369
1184919164_1184919170 -6 Left 1184919164 22:47593533-47593555 CCTCCCTCCCCTCTCTGGCTCTT No data
Right 1184919170 22:47593550-47593572 GCTCTTGCCATGTGATGCACTGG 0: 4
1: 7
2: 28
3: 87
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184919170 Original CRISPR GCTCTTGCCATGTGATGCAC TGG Intergenic
900958302 1:5902112-5902134 GCTCTTGCCCTGAGAGGCATGGG - Intronic
901059858 1:6466991-6467013 GAGCTTGCCATGGGAAGCACTGG - Exonic
902373419 1:16018913-16018935 GCTCTTCCCATGTTACGGACGGG + Intronic
902553158 1:17231124-17231146 GCTGTTGCCATCTTGTGCACAGG - Intronic
902879180 1:19359726-19359748 GCTCTGGCCAGGTGCAGCACAGG + Intronic
903761810 1:25703744-25703766 CCTCTGGCCATGTGATGCCTGGG + Intronic
904718144 1:32484760-32484782 GCTCTGGCCATGTGAAGTGCCGG + Intronic
904887808 1:33754362-33754384 ACTCTTGCCATGTGATACACTGG + Intronic
905375854 1:37519751-37519773 TCTCTTGCCATGTGACACACTGG - Intergenic
907009293 1:50948448-50948470 TCTCTTGCCATGTGATAGTCTGG - Intronic
908395910 1:63725523-63725545 GCTCTAGCCATGTGATATGCTGG - Intergenic
909503519 1:76362156-76362178 GCTCTGGCCATGTGAAGTGCTGG - Intronic
909514124 1:76488298-76488320 GCTTTTGTCATGTGATGTGCCGG + Intronic
909553392 1:76925066-76925088 GCTCTTGCCGTGTGATGCCCTGG - Intronic
909607947 1:77525501-77525523 TCTCTCAACATGTGATGCACTGG - Intronic
910116179 1:83734631-83734653 GCTCTCCCCACGTGATGTACCGG + Intergenic
910469696 1:87539075-87539097 GCTCTGGGCATGTGATGGAAGGG - Intergenic
911756221 1:101560034-101560056 TCTCTTACCATGTGATACACTGG + Intergenic
912632930 1:111263512-111263534 GGTCTGGCCATGTGATGTGCTGG + Intergenic
912667971 1:111599989-111600011 TCTCTTGCCATGTGATGCGCTGG + Intronic
913566780 1:120080417-120080439 TCTCTTGCCATATGACACACTGG + Intergenic
913631350 1:120713132-120713154 TCTCTTGCCATATGACACACTGG - Intergenic
913958420 1:143322397-143322419 GCTCTTGTCCTGTCCTGCACTGG - Intergenic
914052737 1:144147777-144147799 GCTCTTGTCCTGTCCTGCACTGG - Intergenic
914126460 1:144818764-144818786 GCTCTTGTCCTGTCCTGCACTGG + Intergenic
914287536 1:146241124-146241146 TCTCTTGCCATATGACACACTGG + Intergenic
914451043 1:147791718-147791740 TCTCTTGCCATGTAACACACAGG + Intergenic
914548567 1:148691867-148691889 TCTCTTGCCATATGACACACTGG + Intergenic
914618113 1:149379844-149379866 TCTCTTGCCATATGACACACTGG - Intergenic
915661715 1:157410595-157410617 GCTCTGGTCATGTGACACACTGG + Intergenic
915719330 1:157972761-157972783 TTTCTTGCCATGTGATACACTGG - Intergenic
917027725 1:170661389-170661411 GCTCGTGCCATCTGCTGTACTGG - Intergenic
917235755 1:172889861-172889883 TCTCTTGCCATGTGACATACTGG - Intergenic
917408913 1:174737826-174737848 GCTCTTTCCATGTGATATGCTGG - Intronic
918096894 1:181343458-181343480 TCTCTTGCCGTATGAGGCACTGG + Intergenic
918611537 1:186497952-186497974 CCTATTGCCATGTGATGCTCGGG - Intergenic
918615523 1:186540145-186540167 TCTCTTGCCATGTGATATGCTGG - Intergenic
919784355 1:201249917-201249939 CCCCTTGCCATGGGATGCCCTGG - Intergenic
919976697 1:202617401-202617423 GCTCTGGCCATGTGAAGTGCTGG + Intronic
920897985 1:210076702-210076724 GCTCCAGCCATGTGAAGCGCTGG - Intronic
921344642 1:214169863-214169885 GCTCTCACGATGTGATGCTCCGG - Intergenic
921478510 1:215637045-215637067 GAACCTCCCATGTGATGCACAGG - Intronic
921600407 1:217100703-217100725 ACTCTCGCCATGTGATGTGCTGG - Intronic
923906737 1:238393658-238393680 GCTCTAGCCATCTGATGCCCTGG - Intergenic
924855830 1:247874276-247874298 CCTCTTGCCATGTGATACGCTGG - Intronic
1064913862 10:20434808-20434830 TCTCTTGCCATGTGGTACACTGG + Intergenic
1065264029 10:23956741-23956763 ACTCTTGCCACGAGATACACTGG - Intronic
1065856094 10:29831575-29831597 GCTCTGGCCATGTGAAGTGCTGG - Intergenic
1065964662 10:30761447-30761469 TGTCTTGCCATGTGACACACAGG - Intergenic
1066759244 10:38738165-38738187 GCTCTTGTCCTGTCCTGCACTGG + Intergenic
1066962379 10:42234603-42234625 GCTCTTGTCCTGTCCTGCACTGG - Intergenic
1067128525 10:43540865-43540887 TCTCTTGCCATGTGATGCACTGG + Intergenic
1068199311 10:53762795-53762817 GCTCTCGCCATGTGATATGCTGG + Intergenic
1068210812 10:53917929-53917951 GCTCTGGCCATATAACGCACTGG + Intronic
1068331151 10:55571194-55571216 TCTTTTGCCATGTGATGCACAGG + Intronic
1068340778 10:55699479-55699501 CCTCTTGCCATGTGACACACTGG + Intergenic
1068369751 10:56096704-56096726 TCTCTTGCCATGTGACACACTGG - Intergenic
1068891363 10:62151312-62151334 GCTCTGGCCATGTGAAGTACTGG + Intergenic
1069420309 10:68241068-68241090 GCTCATGCTCTGTGCTGCACTGG + Intergenic
1070654990 10:78265333-78265355 CCTCTTGCCTTGTGATACACTGG - Intergenic
1070837663 10:79460364-79460386 TCTCTTGCCGTGTGACACACTGG + Intergenic
1071268466 10:83985142-83985164 ACTCTCACCATGTGATACACAGG - Intergenic
1071664515 10:87541724-87541746 GCTCTCACCATGTGGTACACTGG - Intronic
1072280760 10:93863301-93863323 TCTCTTGCCATGTGACACATTGG + Intergenic
1072295877 10:94009206-94009228 GCTCTTGCCATGTGACATGCTGG - Intronic
1072321353 10:94253300-94253322 GCTCTTGCCATGTCATGCGCTGG - Intronic
1073996055 10:109316656-109316678 TCTCTTGCCAAGTGATGTTCAGG - Intergenic
1074702768 10:116106938-116106960 GCTCTTGCCATGTGAGACACCGG + Intronic
1076002345 10:126922351-126922373 GCTCTTGTCCTGTGATGCATTGG - Intronic
1076196170 10:128519856-128519878 GGTCTTGCAGTGTGAGGCACAGG - Intergenic
1078337693 11:10476910-10476932 GGTCCTGCTAAGTGATGCACTGG - Intronic
1080039028 11:27739450-27739472 GCTCAAGTCAGGTGATGCACAGG + Intergenic
1080318158 11:30973323-30973345 GCTCTGGCCATGTGAAGTACTGG + Intronic
1080369467 11:31618421-31618443 TCTTTTGCCATGTGAGGAACAGG - Intronic
1080894879 11:36440825-36440847 CCTCTTGCCATGTGATACACTGG - Intronic
1081051875 11:38351286-38351308 GCTTTTGCCATGTGATGTGCTGG - Intergenic
1081068221 11:38575870-38575892 GCTCTTGCCATGTGACATTCTGG - Intergenic
1081404699 11:42683500-42683522 CCTCCTGCCATGTGATATACTGG + Intergenic
1081788208 11:45763447-45763469 GCTCTGGCCATGAGATACAGTGG + Intergenic
1085172115 11:74458324-74458346 ACTCTTGCCATTTTATACACAGG + Intronic
1085217166 11:74843197-74843219 GCTCTAGCCTTGTGAGTCACTGG + Exonic
1085383961 11:76145486-76145508 GCTCTTGCCATGTGACATGCTGG + Intergenic
1085750097 11:79154261-79154283 TCTCTTGCCATGTGATGTGCTGG - Intronic
1086005895 11:82035309-82035331 TCTCTCGCCATGTGATACACTGG - Intergenic
1086403905 11:86483951-86483973 GCTCTTTCCCTGTCATGCAGTGG - Intronic
1086554462 11:88092299-88092321 CCTCTTGCCATGTGATACACCGG - Intergenic
1087606224 11:100381978-100382000 TCTCTGGCCATGTGATGAGCTGG + Intergenic
1088028674 11:105219425-105219447 GCTCTGGCCATGTGACGTGCTGG - Intergenic
1088073741 11:105821507-105821529 GCTTCTGCCATGTGAGACACCGG - Intronic
1088352015 11:108900156-108900178 GTTCTTGCCATGTGAGACACTGG + Intronic
1088453925 11:110013964-110013986 TCTCTTGCTATGTGACACACTGG - Intergenic
1090105780 11:123852513-123852535 GCTCTCACCATGTGATGTGCTGG + Intergenic
1090319502 11:125830174-125830196 TCTCTTGCCCTGTGATGTGCTGG - Intergenic
1090638752 11:128712235-128712257 GCTCTTGCTATGTGACACGCTGG + Intronic
1090702536 11:129309543-129309565 CCTTTTGCCATGTGACACACAGG - Intergenic
1091146057 11:133281402-133281424 GCTCTTGCCATGTGACATGCTGG + Intronic
1091325819 11:134686667-134686689 GCTCTTTTCATGTGTTGCCCGGG + Intergenic
1093499423 12:19795359-19795381 TCTCTTACCATGTAATGCATTGG - Intergenic
1094169941 12:27480728-27480750 GCTCTCACCATGTGATACGCTGG + Intronic
1094616883 12:32043952-32043974 TCTCTCGCCATGTGACACACTGG + Intergenic
1095743920 12:45636181-45636203 GCTCTCACCATGTGACACACTGG + Intergenic
1095982045 12:47979479-47979501 GCTCCTGGCATGAGAGGCACAGG - Intronic
1097959827 12:65521568-65521590 GCTCTGGCCATGTGAAGTGCTGG - Intergenic
1098306432 12:69107300-69107322 TCTCTTGCCATGTGACGTGCTGG - Intergenic
1098601037 12:72332089-72332111 GCTCTCACCATGGGATACACTGG - Intronic
1099193341 12:79583713-79583735 TCTCTTGCCATGTGACACATTGG + Intronic
1099481307 12:83169857-83169879 GCTCTTGCCTTGGTCTGCACTGG + Intergenic
1099624465 12:85051202-85051224 TCTCTTGCCATGTGACTCACTGG + Intronic
1100428371 12:94508556-94508578 TCTCTTGCCATGTAATGCTCTGG - Intergenic
1100807784 12:98305267-98305289 TCTCTTGCCTTGTGATACACTGG + Intergenic
1101658969 12:106749282-106749304 GCTCCTACCATGTGGTGCAGTGG + Intronic
1102094022 12:110220820-110220842 GCTCTTTCCATATGATGTGCTGG - Intergenic
1104112193 12:125714527-125714549 TGTCTCGCCATGTCATGCACTGG + Intergenic
1104190438 12:126477318-126477340 GCTCTTGCCATGTGATGTGCTGG - Intergenic
1104542225 12:129676550-129676572 GCTCTCGCCATGTGAAACACTGG - Intronic
1104555706 12:129798081-129798103 ACTCTTGCCATGTGATGTACTGG + Intronic
1104588659 12:130067239-130067261 GCTCTTGCCGTGTGATGCACTGG + Intergenic
1106111042 13:26777166-26777188 ACTCTTGCCATGTGATGTGCTGG - Intergenic
1106399631 13:29417172-29417194 TTTCTCTCCATGTGATGCACTGG - Intronic
1107119628 13:36781989-36782011 TCTCTTGCCATGTGACACACTGG - Intergenic
1107230124 13:38098912-38098934 GCTTTTGCCACATGATACACTGG - Intergenic
1107472657 13:40704781-40704803 TCTCTTGCCATGTGACTCTCTGG + Intergenic
1108425104 13:50291549-50291571 GCTCTCCCCATGTGACACACTGG - Intronic
1108818757 13:54320618-54320640 GCTCTTGCCATGTGATGTGTGGG + Intergenic
1109772639 13:66997312-66997334 GCCCTTGCCATGTGATATGCTGG - Intronic
1111419995 13:87999359-87999381 GCTCTGGCCATGTGAAGTGCCGG + Intergenic
1111729159 13:92051516-92051538 CCAGTTGCCATGTGATGCATAGG + Intronic
1111736986 13:92154121-92154143 TCTCTCTCCATGTGATACACTGG - Intronic
1115121254 14:29940729-29940751 GCTCCAGCCATGTGAAGTACTGG + Intronic
1115916403 14:38320501-38320523 GCTCTGGCCATGTGAAGTGCTGG - Intergenic
1116510375 14:45737898-45737920 TCTCTAGCCATGTGATACGCTGG - Intergenic
1117778659 14:59208892-59208914 TCTCTGGCCATGTGATGTACTGG + Intronic
1118572457 14:67207310-67207332 TCTCTGGCCATGTGATGTGCTGG - Intronic
1119125013 14:72117405-72117427 GCTCTCCCCATGTGATGCATTGG + Intronic
1119564928 14:75620330-75620352 GCTCTTAGCCTGGGATGCACTGG + Intronic
1119598856 14:75960889-75960911 GCTCATGCCATCTGAGGCACTGG - Intronic
1120231975 14:81849944-81849966 TCTCTTACCATGTGATACACTGG - Intergenic
1120506022 14:85353987-85354009 ACTCTTGCCATGTGACATACTGG + Intergenic
1121681071 14:95793041-95793063 GCTCTCATCATGTGAGGCACTGG + Intergenic
1202930819 14_KI270725v1_random:31047-31069 GCTCTGGCCATGCCTTGCACAGG + Intergenic
1123421539 15:20140365-20140387 GCTCTGGCCATGCCTTGCACAGG - Intergenic
1123431811 15:20224243-20224265 GCTGCTGCCATGTGAAGGACAGG + Intergenic
1123442685 15:20302892-20302914 GCTCTTGTCCTGTCCTGCACTGG + Intergenic
1123530765 15:21146905-21146927 GCTCTGGCCATGCCTTGCACAGG - Intergenic
1124492350 15:30165774-30165796 GCTCTGGCCATGTGAAGTGCTGG + Intergenic
1124751186 15:32372543-32372565 GCTCTGGCCATGTGAAGTGCTGG - Intergenic
1126032274 15:44511010-44511032 GGTTGTGCCATGTGATGCAAAGG - Intronic
1126188761 15:45857076-45857098 TTTCTTGCCATGTGACACACCGG + Intergenic
1126218154 15:46181414-46181436 TCTCTTTCCATGTGACACACTGG - Intergenic
1128869272 15:71140317-71140339 TCTCTTGCCGTGTGACACACTGG - Intronic
1129154112 15:73707060-73707082 GCTCTGGCCATTGGAAGCACAGG - Intronic
1131078570 15:89514932-89514954 GCTCCTGCCAGGTCATGCCCAGG - Intergenic
1135463604 16:22665968-22665990 TCTCTTGCCATGTGACACATGGG - Intergenic
1135633773 16:24056701-24056723 GCTCCTACCATGTGATACACGGG + Intronic
1136718569 16:32302835-32302857 GCTCTTGTCCTGTCCTGCACTGG - Intergenic
1136723546 16:32341020-32341042 GCTCTTGTCCTGTCCTGCACTGG - Intergenic
1136773397 16:32859315-32859337 GCTCTTGTCCTGTCCTGCACTGG + Intergenic
1136836940 16:33509099-33509121 GCTCTTGTCCTGTCCTGCACTGG - Intergenic
1136862438 16:33711899-33711921 GCTCTTGTCCTGTCCTGCACTGG + Intergenic
1136897217 16:34002204-34002226 GCTCTTGTCCTGTCCTGCACTGG - Intergenic
1138540809 16:57686277-57686299 ACTCTCGCCATGTGATACGCTGG - Intronic
1138655717 16:58490218-58490240 GCACTTGCGATGGGATGCAGGGG - Intronic
1141153645 16:81582018-81582040 GCTCAAGCCATGTGATGTGCTGG - Intronic
1141448389 16:84079138-84079160 TCTCTTGCCATGTGATGTGCTGG + Intronic
1203002886 16_KI270728v1_random:176745-176767 GCTCTTGTCCTGTCCTGCACTGG + Intergenic
1203007862 16_KI270728v1_random:214936-214958 GCTCTTGTCCTGTCCTGCACTGG + Intergenic
1203075813 16_KI270728v1_random:1121425-1121447 GCTCTTGTCCTGTCCTGCACTGG + Intergenic
1203123932 16_KI270728v1_random:1560082-1560104 GCTCTTGTCCTGTCCTGCACTGG + Intergenic
1203134491 16_KI270728v1_random:1713151-1713173 GCTCTTGTCCTGTCCTGCACTGG + Intergenic
1203147118 16_KI270728v1_random:1809378-1809400 GCTCTTGTCCTGTCCTGCACTGG - Intergenic
1144122308 17:12167002-12167024 GCTCTTGCCATGTGACATGCTGG - Intergenic
1144396857 17:14852801-14852823 GCTCTCATCATGTGAGGCACTGG - Intergenic
1144427132 17:15153768-15153790 TCTCTCGCCATGTGACACACTGG - Intergenic
1144958821 17:19033382-19033404 CGTCTCGCCATGTGATGCGCCGG + Intronic
1144976338 17:19141142-19141164 CGTCTCGCCATGTGATGCGCCGG - Intronic
1149524999 17:57348589-57348611 TTTCTTGCCATGTGATACATTGG + Intronic
1150295399 17:64004739-64004761 CTTCTTGCCATGAGATGGACAGG + Intronic
1150477726 17:65487648-65487670 TCTCTCACCATGGGATGCACTGG - Intergenic
1153224414 18:2887568-2887590 TCTCTTACCATGTGACACACTGG + Intronic
1154484563 18:14863413-14863435 TCTCTTGACACGTGATACACTGG + Intergenic
1155234391 18:23804859-23804881 GTTCTTGCTATGTGATGTACTGG + Intronic
1155901214 18:31393471-31393493 GCCCTTGTCATGTGATGCACTGG - Intronic
1157049493 18:44145284-44145306 GCTCTGGCCATGTGATTTACTGG - Intergenic
1157623225 18:49027961-49027983 TCTCTCGCCACGTGATACACTGG - Intergenic
1157783337 18:50459529-50459551 TCTCTTGCCATGTGATATGCTGG + Intergenic
1158182352 18:54730691-54730713 TCTCTTGCCATGTAATGTGCTGG + Intronic
1158590699 18:58776347-58776369 CCTCTTGCCATGTGACAGACTGG + Intergenic
1158620857 18:59031512-59031534 GGTTTTGCCATGTGCTGCCCAGG + Intergenic
1159384138 18:67700617-67700639 TCTCTTGCCATGTGACACGCTGG + Intergenic
1159880716 18:73856173-73856195 GCTCTGGCCATGTGAAGTTCTGG - Intergenic
1160155587 18:76431706-76431728 GCTCTTGCCATGTGACACATGGG + Intronic
1161600614 19:5180125-5180147 GGTCTTGCTATGTGTTGCCCAGG + Intronic
1164538228 19:29102775-29102797 GCTCTGGCCATGTGAAGTGCTGG + Intergenic
1164913851 19:32034005-32034027 GCTCTTTCCAAGTGTTGCAAAGG + Intergenic
1165278480 19:34775022-34775044 GCTCTCACCATGTGCTACACTGG + Intergenic
1166033507 19:40150555-40150577 GCTCTGGCCATGTAAAGCGCTGG + Intergenic
1167390414 19:49191024-49191046 GCTCTCGCCATGTGATACACTGG - Intronic
1167484340 19:49752428-49752450 GCTCTTGCCAGGTGATATGCTGG + Intronic
1202692133 1_KI270712v1_random:100201-100223 GCTCTTGTCCTGTCCTGCACTGG - Intergenic
925357008 2:3248837-3248859 ATTCTCACCATGTGATGCACTGG + Intronic
926142491 2:10376088-10376110 ACTCTTGCCATGTGACACATTGG + Intronic
926863400 2:17333201-17333223 CCTCTTGCCAAATGAGGCACAGG + Intergenic
928173160 2:29016376-29016398 GCTCATGCCAGCTGCTGCACGGG - Intronic
928224068 2:29432352-29432374 TCCCTTGCCATGTGATACGCAGG + Intronic
930742198 2:54843233-54843255 GGTCTTGCTATGTGGTGCCCAGG - Intronic
931080100 2:58759538-58759560 GCTCTTGCCATGTGATGGTCTGG - Intergenic
931216578 2:60250623-60250645 GCTCTCACCATGTGATACACTGG - Intergenic
931382742 2:61768387-61768409 CCTCTTGCCATGTGACACACTGG - Intergenic
933439674 2:82296917-82296939 TCTCTTGCCATATGATACTCCGG - Intergenic
933954266 2:87353771-87353793 GCTCTTGTCCTGTCCTGCACTGG + Intergenic
934102216 2:88664004-88664026 CCTCTTGCCATGTGATGTGCTGG + Intergenic
934238463 2:90249991-90250013 GCTCTTGTCCTGTCCTGCACTGG + Intergenic
934460886 2:94213333-94213355 GCTCTTGTCCTGTCCTGCACTGG + Intergenic
934461751 2:94216687-94216709 GCTCTGGCCATGCGTCGCACAGG + Intergenic
935006557 2:99084457-99084479 GCCCTTGTCATGTGATGCACTGG + Intronic
935123250 2:100200024-100200046 GCTCTGGCCATGTGAAGTGCTGG + Intergenic
935181482 2:100694862-100694884 TCTCCTGCCATGTGATACACTGG - Intergenic
935534941 2:104283260-104283282 GTTATTGCCATGTGATTCAGTGG - Intergenic
935715923 2:105938856-105938878 GCTCTTGCCATGTGACACGCTGG + Intergenic
936031068 2:109070914-109070936 TCTCTCGCCATGTGGGGCACGGG + Intergenic
936738633 2:115476508-115476530 ACTCTGGCCATGTGATGCATTGG - Intronic
936907095 2:117549398-117549420 GCTCTGGCCATGTGAAGTGCTGG + Intergenic
937146122 2:119646408-119646430 GCTCTGGCCATGTGAGGTGCTGG - Intronic
937948081 2:127359778-127359800 GCTCTGGCCATGTGAAGTGCTGG + Intronic
938057411 2:128226583-128226605 GCTCTTGCTGTGTGATACACTGG + Intergenic
938666445 2:133543227-133543249 TCTCTCGCCATGTGATATACCGG + Intronic
939014633 2:136887592-136887614 CCTCTTGCCATGTGACACACTGG + Intronic
939023923 2:136989442-136989464 TCTCTTCCTATGTGATACACTGG + Intronic
939259129 2:139784154-139784176 TCTCTTGCCATGTGACACACCGG - Intergenic
939396573 2:141638242-141638264 TCTCTTGCCATGTGATGTGCTGG + Intronic
939683345 2:145166952-145166974 TTTCTTGCCATGTGATGAAATGG + Intergenic
940678620 2:156755699-156755721 TCCCTTGCCATGTGATGTGCTGG - Intergenic
940879273 2:158930109-158930131 TCTCTCGCCATGTGACACACTGG + Intergenic
940977094 2:159958272-159958294 GCTCTTGCCATGTGACATGCTGG + Intronic
942481194 2:176390163-176390185 GCCCCTGCCCTGAGATGCACAGG - Intergenic
943580316 2:189675926-189675948 TCTCTTACCATGTGACACACTGG + Intronic
944032475 2:195252217-195252239 TCTCTTGTCATCTGATCCACTGG + Intergenic
944763208 2:202838872-202838894 TTTCTTACCATGTGATGCACTGG - Intronic
945328881 2:208516179-208516201 GCTCTGGCCATGTGATGTGCTGG - Intronic
945617759 2:212094620-212094642 GCTCTCACCATGTGATTCGCAGG + Intronic
946107147 2:217381062-217381084 TCTCTCACCATGTGATGCGCCGG - Intronic
946464274 2:219897494-219897516 TTTCTTGCCATGTGATGCACTGG - Intergenic
947147913 2:227085610-227085632 TCTCTCACCATGTGATACACTGG - Intronic
947249708 2:228088759-228088781 TCTCTTGCCATGTGATGCACTGG + Intronic
947385994 2:229590978-229591000 ACTCTTGCCATGTGACACACTGG + Intronic
948105700 2:235412006-235412028 AATCTGGCCATGTGATGGACCGG + Intergenic
948210806 2:236191738-236191760 TCTCTTGCCATGTGACACACTGG + Intergenic
948813649 2:240498866-240498888 TCTCTTGCCATGTGATGGACAGG + Intronic
949058903 2:241945241-241945263 GCTCTCGCCCTGTGACGCGCAGG + Intergenic
949073649 2:242041380-242041402 CCTCCTGCCATGTGCTGCAGAGG + Intergenic
1169051956 20:2586562-2586584 GCTCTCGCCAAGTGATGTGCTGG - Intronic
1169313778 20:4571148-4571170 CCTCTGGCCATATGATACACAGG - Intergenic
1169745559 20:8939114-8939136 GCTCCAGCCATGTGAAGTACTGG - Intronic
1170580819 20:17698268-17698290 ACTCTTGCCATGTGATACACTGG + Intronic
1170685145 20:18562912-18562934 GTTCTTGCCATGTGGTACATCGG + Intergenic
1170759306 20:19235697-19235719 GCTCAGTCCATGTGATGCGCTGG - Intronic
1170960874 20:21024655-21024677 ACTCTTGCCATGTGACACAGCGG + Intergenic
1172435143 20:34923668-34923690 TCTCTTGCCATGTCAAACACTGG - Intronic
1173365660 20:42382452-42382474 GATATTGCCAAGTGATGTACAGG - Intronic
1173590824 20:44223290-44223312 GCTCTTGCTATGTGACACACAGG + Intergenic
1173715615 20:45201461-45201483 TCTCTCACCATGTGATACACTGG + Intergenic
1174553230 20:51376246-51376268 GCTCTGCCCATGTGATGTGCTGG - Intergenic
1175065336 20:56279862-56279884 TCTCTCACCATGTGATACACTGG + Intergenic
1175645409 20:60666788-60666810 ACTCTCACCATGTGATGCACGGG - Intergenic
1175761450 20:61564525-61564547 ACTCTCACCATGTGATGCCCTGG + Intronic
1176369278 21:6052728-6052750 GCTCTTGCCCAGCGATCCACAGG - Intergenic
1176592839 21:8659670-8659692 GCTCTGGCCATGCCTTGCACAGG + Intergenic
1176796758 21:13376052-13376074 TCTCTTGACACGTGATACACTGG - Intergenic
1177179918 21:17734103-17734125 GCTCTGGCCATGTGAAGCGCTGG - Intergenic
1178755431 21:35345138-35345160 GCTCTTTGCAGGTGATGGACAGG - Intronic
1179076668 21:38128680-38128702 GCACTTGCCAAGTAATACACAGG + Intronic
1179141110 21:38726320-38726342 TCTCTTGCCATGTGATATGCTGG - Intergenic
1179402890 21:41100467-41100489 GCTCTGGCCATGTGAAGTGCTGG + Intergenic
1179754241 21:43485813-43485835 GCTCTTGCCCAGCGATCCACAGG + Intergenic
1180275692 22:10636812-10636834 GCTCTGGCCATGCCTTGCACAGG + Intergenic
1180304474 22:11063540-11063562 TCTCTTGACACGTGATACACTGG + Intergenic
1180549326 22:16528420-16528442 GCTCTTGTCCTGTCCTGCACTGG + Intergenic
1181355366 22:22293416-22293438 GCTCTTGTCCTGTCCTGCACTGG - Intergenic
1184919170 22:47593550-47593572 GCTCTTGCCATGTGATGCACTGG + Intergenic
1184946106 22:47805249-47805271 GCTGTTTCCATGTGATGCACTGG - Intergenic
1203265656 22_KI270734v1_random:12974-12996 ATTCTTTCCATGTGCTGCACAGG + Intergenic
949169417 3:980763-980785 TCTCTTGCCATGTGATACACTGG - Intergenic
950281263 3:11710026-11710048 GCCCTTGCCATGTCATGTGCTGG - Intronic
950860556 3:16144342-16144364 TCTCTTGTCATCTGATGCAGTGG - Intergenic
951191111 3:19772651-19772673 GCTCTAGCCATGTGAAGTTCTGG + Intergenic
954476034 3:50746724-50746746 GCTCTTGCCATGTGATGTACTGG - Intronic
956607026 3:71083268-71083290 GCTCTTGCCATGTGACATGCTGG + Intronic
958671848 3:97216220-97216242 GCTCACACCATGTGATGTACAGG - Intronic
960403481 3:117231817-117231839 GCTCTTGCCATGTCATACGCTGG + Intergenic
960490161 3:118307730-118307752 GCACTTGCCATGTGATATACCGG + Intergenic
961068355 3:123896242-123896264 CCCCTTGCCATGTGATTCCCCGG + Intergenic
961270795 3:125686406-125686428 TGTCTTCCCATGTTATGCACAGG + Intergenic
962554508 3:136533554-136533576 TCTCTCACCATGTGATTCACTGG - Intronic
963470779 3:145739110-145739132 GCTCTGGCCATGTGAAGTGCTGG + Intergenic
963617229 3:147556635-147556657 GATGTTGCCATGTGATGCTCTGG - Intergenic
964468849 3:157030122-157030144 TCTCTCACCATGTGATGCACTGG - Intronic
964920289 3:161887776-161887798 GTTCTTGCCATGTGAGATACTGG - Intergenic
965134215 3:164740741-164740763 TCTCTCACCATGTGATGCACTGG - Intergenic
966577936 3:181524336-181524358 GCTCTTGCCATGTGCTGTCCTGG + Intergenic
967307965 3:188077137-188077159 GATCTTGCCATGCCATGAACAGG + Intergenic
967883708 3:194318928-194318950 GCTCTTCCCATCTCATGCTCAGG - Intergenic
968604206 4:1524048-1524070 GCTCTTTCCAAGTGCTGCACTGG + Intergenic
969107190 4:4816448-4816470 TCTCTTGCCATGTGACACACTGG - Intergenic
969957769 4:10909441-10909463 ACTCTTGCCATGGGATACACTGG - Intergenic
970328593 4:14955245-14955267 TCTCTTGCCATGAGACACACTGG - Intergenic
970628537 4:17916492-17916514 TCTTTTGCCATGTGATGTGCTGG + Intronic
970630311 4:17935622-17935644 TCTCTCACCATGTGATACACTGG + Intronic
971117558 4:23665439-23665461 CCTCCTGCCATGTGATACAGTGG + Intergenic
971524815 4:27603705-27603727 GCTCTCGCCATGTGACACACTGG - Intergenic
971577200 4:28290715-28290737 GCTCTGGCCATGTGAAGTGCTGG - Intergenic
972299803 4:37774025-37774047 TCTCTGGCCATGTGATGTTCTGG - Intergenic
972828611 4:42788586-42788608 TCTCCTGCCATGTGATACACTGG + Intergenic
972955255 4:44381779-44381801 GTTCTCGCCATATGATGCACTGG + Intronic
973708593 4:53603621-53603643 GCTCTTGCTATGTGATACATGGG - Intronic
973848379 4:54936101-54936123 GCTGATGCCATGTGGTGCAGAGG - Intergenic
974086396 4:57265338-57265360 GCTCTCACCATGTGATGTGCTGG - Intergenic
974349355 4:60724462-60724484 GCTTTCGCCATGTGATGTCCAGG + Intergenic
974743171 4:66034453-66034475 CCTCTGGCCATGTGATGTGCTGG - Intergenic
974981571 4:68964074-68964096 ACCCTTGCCATGTGATGCAATGG + Intergenic
977079840 4:92511211-92511233 ACTCTTGCCATGTGATGTGTTGG - Intronic
978408502 4:108404811-108404833 TCTCTCACCATGTGATGCCCTGG - Intergenic
978435725 4:108682249-108682271 GCTCTAACCATGTGAGGCAGGGG + Intergenic
979234544 4:118385105-118385127 TCTCTTGCCATGTGATACACTGG + Intergenic
979718168 4:123866664-123866686 GCTTTTGCCATGTGATATGCCGG + Intergenic
979908592 4:126331377-126331399 GCTCATGTCATCTGATGGACAGG + Intergenic
980007384 4:127558569-127558591 GCTTTGGGCATGTGAGGCACAGG - Intergenic
980678879 4:136128737-136128759 TCTCTTACCATGTGATATACTGG + Intergenic
981409904 4:144417678-144417700 GCTCCGGCCATGTGAGGTACTGG - Intergenic
981832417 4:149017578-149017600 GCCCTTGCCCAGTGATGCCCAGG - Intergenic
981906368 4:149925733-149925755 TCTCTTGCCATGTGATATGCCGG + Intergenic
983013484 4:162579840-162579862 TCTTTTTCCATTTGATGCACTGG - Intergenic
985054958 4:186028039-186028061 TCTCTTGCCTTGTGATACGCTGG + Intergenic
985069128 4:186150968-186150990 GCTCATGCCATGGGAGGCCCAGG - Intronic
985825985 5:2192008-2192030 GCTGCTGCCATGTGAGGCCCGGG + Intergenic
987387568 5:17344544-17344566 GCTCTGGCCATGTGAAGTGCTGG + Intergenic
988263023 5:28912995-28913017 TCTCTTGCCATGTGATGCACTGG + Intergenic
988876827 5:35456280-35456302 GCTCTTGCCAGGTGATATTCTGG + Intergenic
989389699 5:40887101-40887123 TCTCTTGCCATGTGACATACTGG + Intergenic
990248765 5:53891541-53891563 GCTCTTGCCATGTGAAATACAGG + Intronic
990265433 5:54070427-54070449 CCCCTTGCCATGTGATGCCCTGG + Intronic
990552295 5:56895453-56895475 ACTCTTGCCATTTTATGTACTGG + Exonic
991024985 5:62019484-62019506 GCTCTCCCCATGTGATACACTGG + Intergenic
991317617 5:65327154-65327176 TCTCTTGCCATGTGGTGCACTGG + Intronic
991488247 5:67160062-67160084 GTTCTTTCCTTGTGTTGCACTGG + Intronic
991547540 5:67800181-67800203 GCTCTTGCCTGGAGCTGCACTGG - Intergenic
992353232 5:75952653-75952675 CCTCTTGCCATGTGATATACTGG + Intergenic
992409973 5:76495734-76495756 TCTCCTGCCATGTGGTACACAGG - Intronic
993539776 5:89134699-89134721 TCTCTCACTATGTGATGCACTGG - Intergenic
994309589 5:98252904-98252926 TCTCTTGACATGTGATACGCTGG - Intergenic
994840725 5:104922226-104922248 GTTCTTGCCATGTGAGATACTGG + Intergenic
995236828 5:109838443-109838465 TTTGCTGCCATGTGATGCACAGG + Intronic
996411365 5:123162833-123162855 TCTCATTCCATGTGATTCACTGG + Intronic
996492489 5:124114606-124114628 ACTCTGGCCATGTGACACACAGG - Intergenic
996930029 5:128875122-128875144 ACTCTTGCTGTGTGATACACCGG + Intronic
997124268 5:131210061-131210083 GCTCTTGCCCTGTGATAAGCCGG + Intergenic
998028275 5:138839910-138839932 GCTCTTCACATGTGATGCCATGG + Intronic
999261373 5:150240919-150240941 GCCTTTGCCATGGGAGGCACTGG + Intronic
1000351933 5:160358972-160358994 GGTCTTGCCATGTCATCCGCTGG + Intronic
1001132230 5:169073734-169073756 TCTCTTGCCATGTGATGTGAAGG + Intronic
1001253592 5:170167182-170167204 TCTCTTGCCAAGTGTTGCACTGG - Intergenic
1001501750 5:172242084-172242106 TCTCTTGCTATGTGATGCAATGG + Intronic
1004323789 6:14654921-14654943 GCTCTTGCCATGTGATGCACCGG - Intergenic
1004602434 6:17163244-17163266 TCTCTTGCCACGTGACACACTGG + Intergenic
1004617065 6:17300802-17300824 ACTCTTGCCATGGGATGCACTGG - Intergenic
1004868231 6:19875360-19875382 GCGCTTGCCATGTGATATGCTGG + Intergenic
1005433624 6:25784444-25784466 GCTCTCACCATGTGATGCACTGG - Intronic
1005672907 6:28124963-28124985 TCTGTTACCATGAGATGCACGGG - Intronic
1005835264 6:29704032-29704054 GGTCTTGCCACGTGCCGCACTGG + Intergenic
1006063093 6:31440431-31440453 AGTCTTGCCATGTTCTGCACTGG - Intergenic
1006282626 6:33067412-33067434 TCTATGACCATGTGATGCACTGG + Intronic
1007270975 6:40636720-40636742 TTTTTCGCCATGTGATGCACTGG + Intergenic
1007487374 6:42190710-42190732 GTTCTTCCGACGTGATGCACTGG - Intronic
1008758750 6:54828550-54828572 GCTCCCGCCATGTGAAGTACTGG - Intergenic
1009380409 6:63021003-63021025 TCTCTTGCCGTGTGATACGCTGG + Intergenic
1010508589 6:76689700-76689722 TCTCTTGGCATGTGATACATTGG + Intergenic
1010785120 6:79991982-79992004 GCTCTTGCCATGTGACATGCTGG + Intergenic
1012499169 6:99869628-99869650 GCTCTTGCCACGTGATGCACTGG + Intergenic
1012760698 6:103296995-103297017 GCTCTTGCCATGTGACACACTGG - Intergenic
1013234288 6:108183305-108183327 GGTCTTGCCATGTTGTGCCCAGG - Intronic
1013459518 6:110361550-110361572 ATTCTCACCATGTGATGCACTGG - Intergenic
1013504014 6:110781251-110781273 TCTGTTGCCATGTGACACACTGG - Intronic
1013611738 6:111802266-111802288 GCTCTGGCCATGTGAAGTCCTGG + Intronic
1014783662 6:125593172-125593194 GCCCTTGCCAAGTGATACCCTGG + Intergenic
1016621333 6:146112047-146112069 GCTGTTGCCTAGTGGTGCACTGG - Intronic
1016926907 6:149360398-149360420 GCTCTTGCCATGTGACACACTGG - Intronic
1017039027 6:150292907-150292929 TCTCCTGCCATGTGACACACTGG + Intergenic
1017121945 6:151032342-151032364 GCTCTTGCCATGTGATGCACTGG - Intronic
1017484234 6:154888368-154888390 CCCCTTGCCCTGTGATGCCCAGG - Intronic
1018481430 6:164194975-164194997 TCTCTTGCCATGCGATGCAGTGG - Intergenic
1018828933 6:167427359-167427381 CCCCTTACCATGTGATGCCCTGG - Intergenic
1019033532 6:169034401-169034423 ACTCTTGCCATGTGATGCTTTGG - Intergenic
1019631214 7:2050769-2050791 GCTCCTGGCCTGTGAGGCACAGG - Intronic
1020527586 7:9282175-9282197 GCTCTGGCCATGTGAAGACCTGG - Intergenic
1020534911 7:9384894-9384916 GCTCTTTGCATGTGATACGCTGG + Intergenic
1021378733 7:19940412-19940434 CCTCGTGCCATGTTAAGCACTGG - Intergenic
1022632846 7:32101906-32101928 TCTATTGCCATGTGACACACTGG - Intronic
1022907505 7:34871209-34871231 TCTCTTGCCATGTGACATACTGG - Intronic
1024383325 7:48724027-48724049 GCTTTTGCCATGTGATGTGCTGG - Intergenic
1024947874 7:54829459-54829481 TCTCTTGCAATGTGACACACTGG + Intergenic
1025215393 7:57051710-57051732 TCTCTCTCCATGTGATTCACTGG + Intergenic
1025626137 7:63224136-63224158 TCTCTCTCCATGTGATACACTGG + Intergenic
1025655981 7:63518993-63519015 TCTCTCTCCATGTGATTCACTGG - Intergenic
1025939952 7:66068656-66068678 GCTCTTGCTGTGTGATGGGCTGG - Intergenic
1026183170 7:68060206-68060228 TCTCTTGCCATGTGACACATTGG + Intergenic
1026189954 7:68116632-68116654 TCTCTCTCCATGTGATACACTGG + Intergenic
1027495921 7:78887930-78887952 GCACTTGCCAGGTGAGGCAATGG - Intronic
1028927765 7:96378143-96378165 GCTCCTGCCATGTGATGTGCTGG - Intergenic
1029481582 7:100816754-100816776 GGGCATGCCATGTGATCCACAGG + Intronic
1030335497 7:108321379-108321401 TCTCTTGCCAGGTGACACACTGG - Intronic
1030777603 7:113553690-113553712 TCTCTCGCCATGTGACACACTGG - Intergenic
1031192069 7:118565552-118565574 GCTCTTGCCATGTGATATGCTGG - Intergenic
1031232991 7:119134334-119134356 GCTCTCACCATGTGATGTGCTGG - Intergenic
1031420010 7:121540014-121540036 TCTCTTGCCGTGTGATGTGCTGG + Intergenic
1031618370 7:123906760-123906782 GCTCTGGCCATGTGAGGTATGGG - Intergenic
1031797596 7:126195872-126195894 TCTCTTGACATGTGATGTATCGG - Intergenic
1033868561 7:145721551-145721573 TCTCTTGCAATGTGACACACTGG - Intergenic
1034706411 7:153149551-153149573 TCTCTTCCCATGTGATGTCCTGG - Intergenic
1035984544 8:4412381-4412403 GCATTTGCCATGTGTTGCGCTGG + Intronic
1037147643 8:15592560-15592582 GCTCTCACCATGTGATACATTGG + Intronic
1037997050 8:23360332-23360354 TCTCTTTCCATGTGAGACACTGG - Intronic
1039147277 8:34463053-34463075 GCCCTTGTCTTGTGATGCTCTGG - Intergenic
1039285392 8:36034383-36034405 GCTCTGGCCATGTGAAGTACTGG - Intergenic
1039390349 8:37175704-37175726 GCTCTGGCCATGTGAGGTGCCGG - Intergenic
1039402995 8:37287447-37287469 GCTCTGGCCATGTGAAGTGCTGG + Intergenic
1040566313 8:48571038-48571060 GCTCTGGGCATGTGATGCGTAGG + Intergenic
1041117049 8:54549885-54549907 GCTGTTGCCATGTGATCAACAGG - Intergenic
1041398467 8:57417051-57417073 GTTGTTGCCCTGTGAGGCACTGG + Intergenic
1041491643 8:58439039-58439061 GCTCTTGCCATGTGATATGCTGG + Intronic
1041598805 8:59690572-59690594 TCTCTTGCCATGTGATATGCTGG + Intergenic
1043262888 8:78223874-78223896 TCTCTTGCCATATGATGCACTGG + Intergenic
1044085626 8:87938790-87938812 GCTCTTTGGAAGTGATGCACAGG + Intergenic
1044221201 8:89672288-89672310 CCTCTGGCCATGTGATGTGCTGG - Intergenic
1044345654 8:91101108-91101130 GCTCTGGCCATGTGAAGTGCTGG + Intergenic
1044787410 8:95809267-95809289 GCTCTTGCCATGTGATGCACTGG - Intergenic
1045169368 8:99646826-99646848 TCTCTCCCCATGTGATGCGCTGG + Intronic
1045554018 8:103197720-103197742 GCTCTTGCCCTGTGACACGCTGG - Intronic
1046272803 8:111917795-111917817 GCTCTTGGCCTGTGATGGAAGGG + Intergenic
1046540594 8:115576618-115576640 GCTCTTCCCTTGTGATGTAGTGG - Intronic
1046959146 8:120091791-120091813 TCTCTTGCCATGTGACACTCTGG + Intronic
1047316512 8:123739580-123739602 GCTCTTGCCATGAGACATACTGG - Intergenic
1047321316 8:123786519-123786541 GCTCTTGTCATGGGATGGAGGGG + Exonic
1047426102 8:124748436-124748458 GCTCTTGCCATGTGAGGTGCTGG - Intergenic
1047940374 8:129823155-129823177 GCTCTTGCCATATGACATACTGG + Intergenic
1048130561 8:131692920-131692942 GCTTTTGCCACGTGATGTACAGG - Intergenic
1050702384 9:8355210-8355232 CCTTTTGCCATCTGATACACTGG + Intronic
1050810152 9:9735188-9735210 GCACCTGCCATGGGATGCAAAGG + Intronic
1053691382 9:40589031-40589053 GCTCTTGTCCTGTCCTGCACTGG + Intergenic
1053885466 9:42642267-42642289 TCTCTTGACACGTGATACACTGG + Intergenic
1054224485 9:62449716-62449738 TCTCTTGACACGTGATACACTGG + Intergenic
1054273420 9:63048454-63048476 GCTCTTGTCCTGTCCTGCACTGG - Intergenic
1054302642 9:63390002-63390024 GCTCTTGTCCTGTCCTGCACTGG + Intergenic
1054401414 9:64716502-64716524 GCTCTTGTCCTGTCCTGCACTGG + Intergenic
1054435022 9:65200822-65200844 GCTCTTGTCCTGTCCTGCACTGG + Intergenic
1054495368 9:65820859-65820881 GCTCTTGTCCTGTCCTGCACTGG - Intergenic
1054845016 9:69785590-69785612 TCACTTGCCATGTGACACACTGG + Intergenic
1054857253 9:69914361-69914383 GCTCCAGCCATGTGAGGTACCGG + Intergenic
1055773715 9:79745094-79745116 ACTCTTGCCATGTCATTCAGTGG + Intergenic
1056000709 9:82213414-82213436 GCTCCAGCCATGTGAAGTACTGG + Intergenic
1056284115 9:85070739-85070761 TCTCTCACCATGTGATGCACTGG - Intergenic
1057192095 9:93094060-93094082 CCCCTGGCCATGTGATGAACAGG - Intergenic
1057410586 9:94813705-94813727 GCTCTTGGCCTCTGAAGCACAGG + Intronic
1057551955 9:96057597-96057619 TCTCTTGCCATGTGACACACTGG + Intergenic
1057903150 9:98965020-98965042 GCACTTGGCATGTTATGCCCTGG - Intronic
1058149355 9:101446998-101447020 CCTCTTGCCATGTGGTATACTGG - Intergenic
1058177535 9:101754951-101754973 TCTCTTACCATGTGATACACCGG - Intergenic
1058498885 9:105590926-105590948 GCTCTGGCCATGTGAGGTGCGGG - Intronic
1058923072 9:109636414-109636436 ACTCTTGCCATGTGATATACTGG + Intergenic
1059866605 9:118521421-118521443 TCTCTTGCCATGTGATACACCGG + Intergenic
1059917433 9:119118891-119118913 GCTCTCACTATGTGATACACTGG + Intergenic
1060348920 9:122840409-122840431 GCTCTTGCCATGTGATACACTGG - Intergenic
1060785415 9:126448651-126448673 GCTCTTGCCATGTGATACATCGG - Intronic
1061486372 9:130922517-130922539 GCTCTGGCCCTGTCATCCACAGG - Intronic
1203622885 Un_KI270749v1:138476-138498 GCTCTGGCCATGCCTTGCACAGG + Intergenic
1186853125 X:13600141-13600163 GCTTTTGCCATTTGATGCTTGGG + Intronic
1186949486 X:14607621-14607643 GCTCTTGCCATTGGATGCTTAGG + Intronic
1187130036 X:16493900-16493922 GCTCCTGCCATGTGATGTGCTGG - Intergenic
1187686407 X:21819860-21819882 GCTCCTGCCATGTAAGGAACTGG + Intergenic
1188172850 X:26949668-26949690 GCACTGGCCATATGATTCACTGG + Intergenic
1188268236 X:28105294-28105316 ACTCTCGCCATGTGACACACTGG - Intergenic
1189428362 X:40923619-40923641 TCTCTTGCCATGTGACACACTGG + Intergenic
1189760289 X:44315169-44315191 ACTCTCACCATGTGATACACTGG + Intronic
1192846994 X:74916560-74916582 CCCCTTGCCATGTGATGCCATGG + Intronic
1193559843 X:83004752-83004774 GCTCTTGCCATTTTATGGAATGG - Intergenic
1194376650 X:93142861-93142883 GCTCTGGCCATGTGAAGTGCTGG + Intergenic
1194590674 X:95796708-95796730 CCTCTGGCCATGTGAAGCGCTGG + Intergenic
1195690524 X:107620681-107620703 GCTCTTGCCATGTGACATGCTGG - Intergenic
1195735170 X:108005192-108005214 TCTCTTGCCGTGTGATGTGCTGG + Intergenic
1197608988 X:128617288-128617310 ACTCTTGCCATGTGATATGCTGG - Intergenic
1198049720 X:132939015-132939037 TCTCTTGCCATGTGACACACTGG - Intronic
1198658287 X:138938524-138938546 GCTCTTGGCCTGGGATTCACGGG + Intronic
1199497591 X:148470533-148470555 GCTCTTGCCATATGCTTGACTGG - Intergenic
1199684469 X:150254255-150254277 GCCTTTGCCAAGTGTTGCACTGG - Intergenic
1199934471 X:152558774-152558796 TCTCTTACCATGTGATACGCTGG - Intergenic
1201190070 Y:11437692-11437714 GCTCTTGTCCTGTCCTGCACTGG + Intergenic
1202583559 Y:26404235-26404257 GCTCTTGTCCTGTCCTGCACTGG - Intergenic