ID: 1184919172

View in Genome Browser
Species Human (GRCh38)
Location 22:47593561-47593583
Sequence GTGATGCACTGGCTTCCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184919169_1184919172 -4 Left 1184919169 22:47593542-47593564 CCTCTCTGGCTCTTGCCATGTGA No data
Right 1184919172 22:47593561-47593583 GTGATGCACTGGCTTCCCCTTGG No data
1184919167_1184919172 -2 Left 1184919167 22:47593540-47593562 CCCCTCTCTGGCTCTTGCCATGT No data
Right 1184919172 22:47593561-47593583 GTGATGCACTGGCTTCCCCTTGG No data
1184919164_1184919172 5 Left 1184919164 22:47593533-47593555 CCTCCCTCCCCTCTCTGGCTCTT No data
Right 1184919172 22:47593561-47593583 GTGATGCACTGGCTTCCCCTTGG No data
1184919168_1184919172 -3 Left 1184919168 22:47593541-47593563 CCCTCTCTGGCTCTTGCCATGTG No data
Right 1184919172 22:47593561-47593583 GTGATGCACTGGCTTCCCCTTGG No data
1184919165_1184919172 2 Left 1184919165 22:47593536-47593558 CCCTCCCCTCTCTGGCTCTTGCC No data
Right 1184919172 22:47593561-47593583 GTGATGCACTGGCTTCCCCTTGG No data
1184919166_1184919172 1 Left 1184919166 22:47593537-47593559 CCTCCCCTCTCTGGCTCTTGCCA No data
Right 1184919172 22:47593561-47593583 GTGATGCACTGGCTTCCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184919172 Original CRISPR GTGATGCACTGGCTTCCCCT TGG Intergenic
No off target data available for this crispr