ID: 1184919179

View in Genome Browser
Species Human (GRCh38)
Location 22:47593590-47593612
Sequence CCATGAGCGGGAGCTCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184919167_1184919179 27 Left 1184919167 22:47593540-47593562 CCCCTCTCTGGCTCTTGCCATGT No data
Right 1184919179 22:47593590-47593612 CCATGAGCGGGAGCTCCCTGAGG No data
1184919166_1184919179 30 Left 1184919166 22:47593537-47593559 CCTCCCCTCTCTGGCTCTTGCCA No data
Right 1184919179 22:47593590-47593612 CCATGAGCGGGAGCTCCCTGAGG No data
1184919173_1184919179 -9 Left 1184919173 22:47593576-47593598 CCCCTTGGCTTGTGCCATGAGCG No data
Right 1184919179 22:47593590-47593612 CCATGAGCGGGAGCTCCCTGAGG No data
1184919171_1184919179 10 Left 1184919171 22:47593557-47593579 CCATGTGATGCACTGGCTTCCCC No data
Right 1184919179 22:47593590-47593612 CCATGAGCGGGAGCTCCCTGAGG No data
1184919174_1184919179 -10 Left 1184919174 22:47593577-47593599 CCCTTGGCTTGTGCCATGAGCGG No data
Right 1184919179 22:47593590-47593612 CCATGAGCGGGAGCTCCCTGAGG No data
1184919169_1184919179 25 Left 1184919169 22:47593542-47593564 CCTCTCTGGCTCTTGCCATGTGA No data
Right 1184919179 22:47593590-47593612 CCATGAGCGGGAGCTCCCTGAGG No data
1184919168_1184919179 26 Left 1184919168 22:47593541-47593563 CCCTCTCTGGCTCTTGCCATGTG No data
Right 1184919179 22:47593590-47593612 CCATGAGCGGGAGCTCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184919179 Original CRISPR CCATGAGCGGGAGCTCCCTG AGG Intergenic
No off target data available for this crispr