ID: 1184919180

View in Genome Browser
Species Human (GRCh38)
Location 22:47593600-47593622
Sequence GAGCTCCCTGAGGCCTCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184919173_1184919180 1 Left 1184919173 22:47593576-47593598 CCCCTTGGCTTGTGCCATGAGCG No data
Right 1184919180 22:47593600-47593622 GAGCTCCCTGAGGCCTCACCAGG No data
1184919176_1184919180 -1 Left 1184919176 22:47593578-47593600 CCTTGGCTTGTGCCATGAGCGGG No data
Right 1184919180 22:47593600-47593622 GAGCTCCCTGAGGCCTCACCAGG No data
1184919171_1184919180 20 Left 1184919171 22:47593557-47593579 CCATGTGATGCACTGGCTTCCCC No data
Right 1184919180 22:47593600-47593622 GAGCTCCCTGAGGCCTCACCAGG No data
1184919174_1184919180 0 Left 1184919174 22:47593577-47593599 CCCTTGGCTTGTGCCATGAGCGG No data
Right 1184919180 22:47593600-47593622 GAGCTCCCTGAGGCCTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184919180 Original CRISPR GAGCTCCCTGAGGCCTCACC AGG Intergenic
No off target data available for this crispr